ID: 969704871

View in Genome Browser
Species Human (GRCh38)
Location 4:8786198-8786220
Sequence GGCCCAGCAGACGCCACTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969704866_969704871 -2 Left 969704866 4:8786177-8786199 CCCTATGAATCCCGCACGGGAGG No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704865_969704871 -1 Left 969704865 4:8786176-8786198 CCCCTATGAATCCCGCACGGGAG No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704861_969704871 8 Left 969704861 4:8786167-8786189 CCCAGGCATCCCCTATGAATCCC No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704860_969704871 16 Left 969704860 4:8786159-8786181 CCTGGGAGCCCAGGCATCCCCTA No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704868_969704871 -3 Left 969704868 4:8786178-8786200 CCTATGAATCCCGCACGGGAGGC No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704857_969704871 26 Left 969704857 4:8786149-8786171 CCAGCAGAGCCCTGGGAGCCCAG No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704862_969704871 7 Left 969704862 4:8786168-8786190 CCAGGCATCCCCTATGAATCCCG No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data
969704859_969704871 17 Left 969704859 4:8786158-8786180 CCCTGGGAGCCCAGGCATCCCCT No data
Right 969704871 4:8786198-8786220 GGCCCAGCAGACGCCACTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969704871 Original CRISPR GGCCCAGCAGACGCCACTGC CGG Intergenic