ID: 969712540

View in Genome Browser
Species Human (GRCh38)
Location 4:8852252-8852274
Sequence CATCCAGTGAACGCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969712538_969712540 -10 Left 969712538 4:8852239-8852261 CCAGCAAGGCAGACATCCAGTGA 0: 1
1: 0
2: 0
3: 20
4: 193
Right 969712540 4:8852252-8852274 CATCCAGTGAACGCGGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969712540 Original CRISPR CATCCAGTGAACGCGGCTGC AGG Intronic
908879087 1:68710432-68710454 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
909866983 1:80686060-80686082 CATCCAGTGAAAGTAGCTACAGG - Intergenic
910771471 1:90836100-90836122 CATCCAGGGTCCGCGGCCGCAGG + Intergenic
911626709 1:100132714-100132736 CATCCAGTGCCCGCGGGTGGCGG - Intronic
919044264 1:192431060-192431082 CAGCCAGTGAAGGCAACTGCAGG + Intergenic
921013786 1:211168777-211168799 CATCCCATGAAAGCAGCTGCAGG - Intergenic
923629549 1:235640852-235640874 CATCCAGGGACTGGGGCTGCTGG - Intronic
924850473 1:247824139-247824161 AATCCAGTGAACTCTGATGCTGG - Intergenic
1067777965 10:49176669-49176691 CATCCAGGGAGCGGGGCTGTGGG + Intronic
1071853475 10:89599475-89599497 CATCCAGTTTATGCAGCTGCAGG + Exonic
1076730429 10:132436354-132436376 CATCCAGTGAAGGGGCCTGGGGG - Intergenic
1079952632 11:26823671-26823693 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
1082007169 11:47425881-47425903 CATCCAGCGCACACGGCTGCTGG - Exonic
1085099390 11:73787903-73787925 CGCCCTGGGAACGCGGCTGCAGG + Exonic
1100843130 12:98633080-98633102 CATCCTGTGCATGGGGCTGCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1109906291 13:68846286-68846308 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1111778684 13:92694376-92694398 CAGCCTGTGAAAGCAGCTGCAGG + Intronic
1115944469 14:38644070-38644092 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1122199706 14:100114928-100114950 CCTCCAGTGAACGGTGCTGCTGG - Intronic
1122341021 14:101028567-101028589 TATCCAGGGTAGGCGGCTGCTGG + Intergenic
1131007824 15:88992913-88992935 CCTCCACTGAACTCTGCTGCAGG - Intergenic
1135887322 16:26322193-26322215 GCTCCTGTGAAAGCGGCTGCAGG - Intergenic
1142187435 16:88701218-88701240 CATCAAGTGACCCCGGCTCCAGG + Intronic
1144771737 17:17763272-17763294 CACCCAGTGACCACGGCTGCTGG + Intronic
1152286018 17:79413796-79413818 CAGCCAGTGCACATGGCTGCTGG - Intronic
1153810930 18:8750898-8750920 CATCCAGAGAAGGCAACTGCAGG - Intronic
1157509808 18:48262858-48262880 CATCCAGTGATACTGGCTGCTGG - Intronic
1159892268 18:73964101-73964123 CAGCCAGTGAAGGCAGCTGTGGG - Intergenic
1161391638 19:4024194-4024216 CCTGCAGTGGACGTGGCTGCCGG - Intronic
1164489388 19:28692731-28692753 CAGCCAGTGAGAGCAGCTGCAGG + Intergenic
1165944784 19:39435574-39435596 CATCCACTCAACGCCGGTGCCGG + Intronic
925800559 2:7595369-7595391 CATGCAGAGAACCCAGCTGCTGG - Intergenic
932083081 2:68732868-68732890 TATCCAGAGAACGAGGCTGAAGG - Intronic
940833024 2:158489571-158489593 CATCCAGCTAAGGCAGCTGCAGG - Intronic
942646220 2:178113083-178113105 CACCCGGTGGCCGCGGCTGCCGG - Intronic
943880005 2:193131317-193131339 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
943983380 2:194586880-194586902 CATCCATTGAACCTGACTGCAGG + Intergenic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1174290849 20:49507508-49507530 TATCCAGTCAAAGCGGATGCTGG - Exonic
1175811161 20:61858699-61858721 CATCCAGAGAACGATGCTGCAGG - Intronic
1176545754 21:8197389-8197411 CATCCAGTTGACACGGCCGCGGG + Intergenic
1176564705 21:8380434-8380456 CATCCAGTTGACACGGCCGCGGG + Intergenic
1178954015 21:37007029-37007051 CCTCCCGGGAACCCGGCTGCCGG - Intronic
1179318469 21:40268278-40268300 CATTCAGTGAACCCTGCTGATGG + Intronic
1181269645 22:21651789-21651811 CCTGCTGTGAACGCGGCCGCGGG - Intergenic
1182263074 22:29089861-29089883 AACCCAGTGAACGAGGCGGCAGG - Intronic
1185187050 22:49407431-49407453 CCTCCTGTGAACGCTGATGCCGG - Intergenic
1203250625 22_KI270733v1_random:113626-113648 CATCCAGTTGACACGGCCGCGGG + Intergenic
959149499 3:102591550-102591572 CAGCCAGTGAAAGCAGCTGAGGG + Intergenic
959171317 3:102847747-102847769 CAGCCAGTGAAAGCAGCTGCAGG - Intergenic
959337004 3:105079418-105079440 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
961564587 3:127754477-127754499 CATCCAGTTAACGCCGGTGAGGG - Intronic
965046465 3:163584610-163584632 CAGCCTGTGAAGGCAGCTGCAGG - Intergenic
969712540 4:8852252-8852274 CATCCAGTGAACGCGGCTGCAGG + Intronic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
976706756 4:88027216-88027238 CAGCCTGTGAAAGCAGCTGCAGG + Intronic
979060847 4:116058942-116058964 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
982627504 4:157786002-157786024 CAACCTGTGAAAGCAGCTGCAGG - Intergenic
985368551 4:189260506-189260528 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
985773116 5:1825307-1825329 CTCCCAGTGCATGCGGCTGCAGG - Intergenic
986557715 5:9027742-9027764 CAGCCAGTGAAAGCAGCTGCAGG + Intergenic
988142678 5:27263943-27263965 CAACCTGTGAAAGCAGCTGCAGG + Intergenic
992095361 5:73357808-73357830 CATCCAGTGGACGGGCCTGGGGG - Intergenic
992154153 5:73938476-73938498 CATCCAGTGAATGAGGCAGCTGG - Intronic
992444331 5:76820141-76820163 CATCCAAGGAACGCGACGGCCGG - Intronic
995779754 5:115762656-115762678 CAGCCAGTGAAAGCAGCTGTGGG - Intergenic
1015652552 6:135479307-135479329 CAGCCAGTGAAAGCAGCTGCAGG + Intronic
1017978747 6:159380189-159380211 CACCCAGTGCACTCAGCTGCAGG + Intergenic
1021787204 7:24164126-24164148 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1024200872 7:47104235-47104257 CATCCAGGGAAAGGGGCTGTAGG + Intergenic
1024738848 7:52334369-52334391 CATCCAGTGAAAGTGTCTACTGG + Intergenic
1026494875 7:70893468-70893490 AATCCAGTGCACGCTGCCGCAGG - Intergenic
1027645222 7:80789335-80789357 GATCGAGTGAACGCTGCTGATGG - Exonic
1034423076 7:150999278-150999300 CAGCCACTGAAGGGGGCTGCGGG - Exonic
1035341117 7:158162810-158162832 CAGTCAGTCAACGAGGCTGCGGG - Intronic
1036371690 8:8168007-8168029 CCTTCAGTGAACGGGGCAGCTGG + Intergenic
1036879213 8:12497637-12497659 CCTTCAGTGAACGGGGCAGCTGG - Intergenic
1037411716 8:18605183-18605205 CATCCCATGAGCGCAGCTGCAGG + Intronic
1038484148 8:27921748-27921770 CCTCCACCGCACGCGGCTGCAGG - Exonic
1039759126 8:40555746-40555768 CATCTAGTGAAGGAGGCTGGGGG - Intronic
1042176998 8:66046858-66046880 CATCCGGAGAACGTGGCTGCAGG - Intronic
1047923338 8:129657491-129657513 CATCCTATGAAAGCAGCTGCAGG - Intergenic
1053652053 9:40178631-40178653 CATCCATTGAAAGCCACTGCTGG + Intergenic
1053902444 9:42807945-42807967 CATCCATTGAAAGCCACTGCTGG + Intergenic
1054532533 9:66197575-66197597 CATCCATTGAAAGCCACTGCTGG - Intergenic
1058539028 9:105992757-105992779 GATTCAGAGAAGGCGGCTGCAGG + Intergenic
1058707439 9:107649087-107649109 CATGCAGTGATCTCGGGTGCAGG + Intergenic
1061891769 9:133625435-133625457 CATCCTGTGAAAGCAGCTGTGGG - Intergenic
1203467026 Un_GL000220v1:96898-96920 CATCCAGTTGACACGGCCGCGGG + Intergenic
1187456398 X:19444991-19445013 CATCCAGTGGACGAGGAAGCTGG - Intronic