ID: 969718096

View in Genome Browser
Species Human (GRCh38)
Location 4:8877989-8878011
Sequence CAGCTCGGTGGCCCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718096_969718104 5 Left 969718096 4:8877989-8878011 CCTGTGCCAGGGCCACCGAGCTG No data
Right 969718104 4:8878017-8878039 CCTTGCCCTCCATTCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718096 Original CRISPR CAGCTCGGTGGCCCTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr