ID: 969718186

View in Genome Browser
Species Human (GRCh38)
Location 4:8878437-8878459
Sequence CAGAGCATCCATCCTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718186_969718191 21 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data
969718186_969718190 18 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data
969718186_969718193 29 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718193 4:8878489-8878511 ATCAGGCACTGGAGGTAGACTGG No data
969718186_969718189 12 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718189 4:8878472-8878494 AGAAGTGTGATGCCAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718186 Original CRISPR CAGAGCATCCATCCTCCAGG CGG (reversed) Intergenic