ID: 969718188

View in Genome Browser
Species Human (GRCh38)
Location 4:8878440-8878462
Sequence CACCAGAGCATCCATCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718188_969718193 26 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718193 4:8878489-8878511 ATCAGGCACTGGAGGTAGACTGG No data
969718188_969718191 18 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data
969718188_969718189 9 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718189 4:8878472-8878494 AGAAGTGTGATGCCAAAATCAGG No data
969718188_969718190 15 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718188 Original CRISPR CACCAGAGCATCCATCCTCC AGG (reversed) Intergenic
No off target data available for this crispr