ID: 969718190

View in Genome Browser
Species Human (GRCh38)
Location 4:8878478-8878500
Sequence GTGATGCCAAAATCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718188_969718190 15 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data
969718182_969718190 28 Left 969718182 4:8878427-8878449 CCCCAGGAAACCGCCTGGAGGAT No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data
969718184_969718190 26 Left 969718184 4:8878429-8878451 CCAGGAAACCGCCTGGAGGATGG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data
969718186_969718190 18 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data
969718183_969718190 27 Left 969718183 4:8878428-8878450 CCCAGGAAACCGCCTGGAGGATG No data
Right 969718190 4:8878478-8878500 GTGATGCCAAAATCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718190 Original CRISPR GTGATGCCAAAATCAGGCAC TGG Intergenic
No off target data available for this crispr