ID: 969718191

View in Genome Browser
Species Human (GRCh38)
Location 4:8878481-8878503
Sequence ATGCCAAAATCAGGCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718186_969718191 21 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data
969718184_969718191 29 Left 969718184 4:8878429-8878451 CCAGGAAACCGCCTGGAGGATGG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data
969718188_969718191 18 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data
969718183_969718191 30 Left 969718183 4:8878428-8878450 CCCAGGAAACCGCCTGGAGGATG No data
Right 969718191 4:8878481-8878503 ATGCCAAAATCAGGCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718191 Original CRISPR ATGCCAAAATCAGGCACTGG AGG Intergenic
No off target data available for this crispr