ID: 969718193

View in Genome Browser
Species Human (GRCh38)
Location 4:8878489-8878511
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718186_969718193 29 Left 969718186 4:8878437-8878459 CCGCCTGGAGGATGGATGCTCTG No data
Right 969718193 4:8878489-8878511 ATCAGGCACTGGAGGTAGACTGG No data
969718188_969718193 26 Left 969718188 4:8878440-8878462 CCTGGAGGATGGATGCTCTGGTG No data
Right 969718193 4:8878489-8878511 ATCAGGCACTGGAGGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type