ID: 969718952

View in Genome Browser
Species Human (GRCh38)
Location 4:8882504-8882526
Sequence CTCAGGGCTCTGCGCACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969718945_969718952 28 Left 969718945 4:8882453-8882475 CCGAGATTGTCATCAGACAGAGG No data
Right 969718952 4:8882504-8882526 CTCAGGGCTCTGCGCACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969718952 Original CRISPR CTCAGGGCTCTGCGCACAGT AGG Intergenic
No off target data available for this crispr