ID: 969725059

View in Genome Browser
Species Human (GRCh38)
Location 4:8913860-8913882
Sequence CACCGGTCATGTTGGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969725059_969725063 -7 Left 969725059 4:8913860-8913882 CCCTTAATCCAACATGACCGGTG No data
Right 969725063 4:8913876-8913898 ACCGGTGTCCCCATAAAAGGTGG No data
969725059_969725062 -10 Left 969725059 4:8913860-8913882 CCCTTAATCCAACATGACCGGTG No data
Right 969725062 4:8913873-8913895 ATGACCGGTGTCCCCATAAAAGG No data
969725059_969725066 1 Left 969725059 4:8913860-8913882 CCCTTAATCCAACATGACCGGTG No data
Right 969725066 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
969725059_969725072 30 Left 969725059 4:8913860-8913882 CCCTTAATCCAACATGACCGGTG No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969725059 Original CRISPR CACCGGTCATGTTGGATTAA GGG (reversed) Intergenic
No off target data available for this crispr