ID: 969725060

View in Genome Browser
Species Human (GRCh38)
Location 4:8913861-8913883
Sequence ACACCGGTCATGTTGGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969725060_969725066 0 Left 969725060 4:8913861-8913883 CCTTAATCCAACATGACCGGTGT No data
Right 969725066 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
969725060_969725063 -8 Left 969725060 4:8913861-8913883 CCTTAATCCAACATGACCGGTGT No data
Right 969725063 4:8913876-8913898 ACCGGTGTCCCCATAAAAGGTGG No data
969725060_969725072 29 Left 969725060 4:8913861-8913883 CCTTAATCCAACATGACCGGTGT No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969725060 Original CRISPR ACACCGGTCATGTTGGATTA AGG (reversed) Intergenic
No off target data available for this crispr