ID: 969725061

View in Genome Browser
Species Human (GRCh38)
Location 4:8913868-8913890
Sequence TATGGGGACACCGGTCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969725061_969725076 30 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725076 4:8913921-8913943 ACAGAGAGAACGTGGTGGGAAGG No data
969725061_969725073 25 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725073 4:8913916-8913938 TGTCCACAGAGAGAACGTGGTGG No data
969725061_969725066 -7 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725066 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
969725061_969725072 22 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725061_969725074 26 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725074 4:8913917-8913939 GTCCACAGAGAGAACGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969725061 Original CRISPR TATGGGGACACCGGTCATGT TGG (reversed) Intergenic
No off target data available for this crispr