ID: 969725065

View in Genome Browser
Species Human (GRCh38)
Location 4:8913884-8913906
Sequence CCAAACATCCACCTTTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969725065_969725072 6 Left 969725065 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725065_969725076 14 Left 969725065 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
Right 969725076 4:8913921-8913943 ACAGAGAGAACGTGGTGGGAAGG No data
969725065_969725073 9 Left 969725065 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
Right 969725073 4:8913916-8913938 TGTCCACAGAGAGAACGTGGTGG No data
969725065_969725074 10 Left 969725065 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
Right 969725074 4:8913917-8913939 GTCCACAGAGAGAACGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969725065 Original CRISPR CCAAACATCCACCTTTTATG GGG (reversed) Intergenic
No off target data available for this crispr