ID: 969725072

View in Genome Browser
Species Human (GRCh38)
Location 4:8913913-8913935
Sequence CCATGTCCACAGAGAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969725059_969725072 30 Left 969725059 4:8913860-8913882 CCCTTAATCCAACATGACCGGTG No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725065_969725072 6 Left 969725065 4:8913884-8913906 CCCCATAAAAGGTGGATGTTTGG No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725061_969725072 22 Left 969725061 4:8913868-8913890 CCAACATGACCGGTGTCCCCATA No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725067_969725072 5 Left 969725067 4:8913885-8913907 CCCATAAAAGGTGGATGTTTGGA No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725064_969725072 13 Left 969725064 4:8913877-8913899 CCGGTGTCCCCATAAAAGGTGGA No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725060_969725072 29 Left 969725060 4:8913861-8913883 CCTTAATCCAACATGACCGGTGT No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data
969725068_969725072 4 Left 969725068 4:8913886-8913908 CCATAAAAGGTGGATGTTTGGAC No data
Right 969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969725072 Original CRISPR CCATGTCCACAGAGAGAACG TGG Intergenic
No off target data available for this crispr