ID: 969728973

View in Genome Browser
Species Human (GRCh38)
Location 4:8942387-8942409
Sequence GCTCGTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969728968_969728973 -10 Left 969728968 4:8942374-8942396 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG No data
969728966_969728973 -6 Left 969728966 4:8942370-8942392 CCACCCCTCCCTCGGCAGCTCGT No data
Right 969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG No data
969728967_969728973 -9 Left 969728967 4:8942373-8942395 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG No data
969728965_969728973 -1 Left 969728965 4:8942365-8942387 CCATTCCACCCCTCCCTCGGCAG No data
Right 969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969728973 Original CRISPR GCTCGTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr