ID: 969729473

View in Genome Browser
Species Human (GRCh38)
Location 4:8945539-8945561
Sequence ATCACGCTCCATGCACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969729473_969729474 5 Left 969729473 4:8945539-8945561 CCTTCAAGTGCATGGAGCGTGAT No data
Right 969729474 4:8945567-8945589 GAAAAGCGCCTATTGAACTCTGG No data
969729473_969729477 8 Left 969729473 4:8945539-8945561 CCTTCAAGTGCATGGAGCGTGAT No data
Right 969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG No data
969729473_969729475 6 Left 969729473 4:8945539-8945561 CCTTCAAGTGCATGGAGCGTGAT No data
Right 969729475 4:8945568-8945590 AAAAGCGCCTATTGAACTCTGGG No data
969729473_969729476 7 Left 969729473 4:8945539-8945561 CCTTCAAGTGCATGGAGCGTGAT No data
Right 969729476 4:8945569-8945591 AAAGCGCCTATTGAACTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969729473 Original CRISPR ATCACGCTCCATGCACTTGA AGG (reversed) Intergenic
No off target data available for this crispr