ID: 969729477

View in Genome Browser
Species Human (GRCh38)
Location 4:8945570-8945592
Sequence AAGCGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969729473_969729477 8 Left 969729473 4:8945539-8945561 CCTTCAAGTGCATGGAGCGTGAT No data
Right 969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG No data
969729472_969729477 9 Left 969729472 4:8945538-8945560 CCCTTCAAGTGCATGGAGCGTGA No data
Right 969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969729477 Original CRISPR AAGCGCCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr