ID: 969732206

View in Genome Browser
Species Human (GRCh38)
Location 4:8963995-8964017
Sequence GAGGAGGGAGGCTGAGTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969732206_969732219 10 Left 969732206 4:8963995-8964017 CCCCGGACTCAGCCTCCCTCCTC No data
Right 969732219 4:8964028-8964050 GTTTACCACGTCTTAGGTCGGGG No data
969732206_969732215 4 Left 969732206 4:8963995-8964017 CCCCGGACTCAGCCTCCCTCCTC No data
Right 969732215 4:8964022-8964044 GCCTCAGTTTACCACGTCTTAGG No data
969732206_969732220 11 Left 969732206 4:8963995-8964017 CCCCGGACTCAGCCTCCCTCCTC No data
Right 969732220 4:8964029-8964051 TTTACCACGTCTTAGGTCGGGGG No data
969732206_969732217 8 Left 969732206 4:8963995-8964017 CCCCGGACTCAGCCTCCCTCCTC No data
Right 969732217 4:8964026-8964048 CAGTTTACCACGTCTTAGGTCGG No data
969732206_969732218 9 Left 969732206 4:8963995-8964017 CCCCGGACTCAGCCTCCCTCCTC No data
Right 969732218 4:8964027-8964049 AGTTTACCACGTCTTAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969732206 Original CRISPR GAGGAGGGAGGCTGAGTCCG GGG (reversed) Intergenic
No off target data available for this crispr