ID: 969733777

View in Genome Browser
Species Human (GRCh38)
Location 4:8973408-8973430
Sequence CATGTGGGTCCAACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733777_969733785 13 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG No data
969733777_969733788 29 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG No data
969733777_969733783 -3 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733783 4:8973428-8973450 ATGAAAGAGAGGATATGCAAAGG No data
969733777_969733784 12 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG No data
969733777_969733787 25 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733777 Original CRISPR CATGTGGGTCCAACTGGGTG TGG (reversed) Intergenic