ID: 969733778

View in Genome Browser
Species Human (GRCh38)
Location 4:8973413-8973435
Sequence TCTTTCATGTGGGTCCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733778_969733788 24 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733778_969733784 7 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733778_969733787 20 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733778_969733783 -8 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733783 4:8973428-8973450 ATGAAAGAGAGGATATGCAAAGG 0: 42
1: 22
2: 15
3: 41
4: 461
969733778_969733785 8 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733778 Original CRISPR TCTTTCATGTGGGTCCAACT GGG (reversed) Intergenic
No off target data available for this crispr