ID: 969733779

View in Genome Browser
Species Human (GRCh38)
Location 4:8973414-8973436
Sequence CTCTTTCATGTGGGTCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733779_969733784 6 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733779_969733783 -9 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733783 4:8973428-8973450 ATGAAAGAGAGGATATGCAAAGG 0: 42
1: 22
2: 15
3: 41
4: 461
969733779_969733787 19 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733779_969733788 23 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733779_969733785 7 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733779 Original CRISPR CTCTTTCATGTGGGTCCAAC TGG (reversed) Intergenic
No off target data available for this crispr