ID: 969733781

View in Genome Browser
Species Human (GRCh38)
Location 4:8973423-8973445
Sequence GCATATCCTCTCTTTCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 32, 1: 30, 2: 6, 3: 28, 4: 305}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733781_969733790 25 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733790 4:8973471-8973493 TCTCTTGGAAGGATTCAAGAGGG No data
969733781_969733784 -3 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733781_969733788 14 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733781_969733787 10 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733781_969733785 -2 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733781_969733789 24 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733789 4:8973470-8973492 CTCTCTTGGAAGGATTCAAGAGG No data
969733781_969733791 26 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733791 4:8973472-8973494 CTCTTGGAAGGATTCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733781 Original CRISPR GCATATCCTCTCTTTCATGT GGG (reversed) Intergenic
900082819 1:871734-871756 GCATATATTCTCTTTCTTCTTGG + Intergenic
901834944 1:11918042-11918064 GCATCTCCTCTCTACCATGGTGG + Intergenic
901989730 1:13102913-13102935 GCATACCCTGTCTTTCATTTGGG - Intergenic
901992082 1:13123839-13123861 GCATACCCTGTCTTTCATTTGGG + Intergenic
903590621 1:24453127-24453149 TCATATCCACTCTTTCTTGGAGG - Intronic
905627468 1:39498293-39498315 ACACATCCTCTCTTGCCTGTGGG - Intronic
906545723 1:46617948-46617970 GCATATTCTCACTTACAAGTAGG + Intergenic
907012927 1:50979904-50979926 GTATATCCTGTCTTACATTTTGG + Intergenic
908071116 1:60461310-60461332 GCATATTCTCACTCACATGTGGG + Intergenic
908854500 1:68409552-68409574 GCCTATTCTCTCTTTCATTATGG - Intergenic
909329736 1:74396774-74396796 GAATCTCCTCTTTTTCTTGTTGG - Intronic
909524879 1:76611870-76611892 TCATATCATCTCTTTCAAGAAGG - Intronic
909994304 1:82260342-82260364 GCATATTCTCACTTACAAGTGGG + Intergenic
910135660 1:83966197-83966219 CAGAATCCTCTCTTTCATGTGGG - Intronic
911796253 1:102080384-102080406 GCATATTCTCACTTATATGTGGG + Intergenic
913311209 1:117496741-117496763 GAATATCTTTTCTTTCCTGTAGG + Exonic
915785115 1:158602528-158602550 GCATGTTCTCACTTTCATGTGGG + Intergenic
918777328 1:188650653-188650675 GCATGTTCTCTCTTTTAAGTGGG + Intergenic
918789857 1:188812750-188812772 GCATGTTCTCTCTTACAAGTGGG + Intergenic
919354298 1:196501508-196501530 GCATATCCTCACTTATAAGTGGG + Intronic
919597899 1:199587368-199587390 GCATCACCACTCTTGCATGTTGG + Intergenic
921118323 1:212115180-212115202 GAAAATCCCCTATTTCATGTAGG + Intergenic
921552116 1:216549946-216549968 GCATATGTTTTCTGTCATGTTGG + Intronic
921836291 1:219782337-219782359 GTCTATCCCCTCTTTCCTGTTGG - Intronic
923071364 1:230567728-230567750 GCATGTTCTCACTTGCATGTGGG + Intergenic
924388856 1:243528548-243528570 GCATATTCTCACTTACAAGTGGG - Intronic
924669011 1:246104237-246104259 GCATATTCGCTCTTACAAGTGGG - Intronic
924762662 1:247003365-247003387 GCATGTTCTCTCTTATATGTGGG + Intronic
1064394917 10:14974148-14974170 GCATATCCTCTCTTTCATGTGGG + Intronic
1064395972 10:14982278-14982300 GCATATCCTCTCTTTCATGTGGG + Intronic
1064397670 10:14994464-14994486 GCATATCCTCTCTTCCATGTGGG + Intergenic
1064403989 10:15044554-15044576 GCATCTCCTATCTTCCATCTGGG + Intronic
1065190387 10:23202874-23202896 TCATTTCCTCTGTTTCTTGTAGG + Intergenic
1065881518 10:30041281-30041303 GCAAAGCCTCTCTTTCTTGAGGG - Intronic
1066389989 10:34970719-34970741 GCTTATCCTTTCTTTCATTTGGG - Intergenic
1068977523 10:63025624-63025646 GCATTTCCAAACTTTCATGTAGG - Intergenic
1069262979 10:66422461-66422483 AAATATTCTGTCTTTCATGTAGG + Intronic
1070628639 10:78068680-78068702 GCACATTCTGTTTTTCATGTCGG + Intergenic
1074524089 10:114249563-114249585 GCATATTCTCACTTACAAGTGGG - Intronic
1074975884 10:118581320-118581342 GCATAGCCTCTCATCCTTGTAGG - Intergenic
1075593064 10:123706666-123706688 GCACCTCCTCTCTTTCCTCTTGG + Intronic
1075816405 10:125267833-125267855 GCACATTCTCACTTACATGTTGG - Intergenic
1077519829 11:3026107-3026129 ACATGTCCTCTCTCTTATGTGGG + Intronic
1077589421 11:3480200-3480222 GCATATCCTCTCTTTCATGTGGG + Intergenic
1078123581 11:8536015-8536037 GCATGTTCTCACTTACATGTGGG + Intronic
1079347386 11:19664785-19664807 CCATTTCCTCTCCTTCATTTGGG - Intronic
1079415525 11:20232337-20232359 GCATATCCTCACTTATTTGTGGG + Intergenic
1079960996 11:26923033-26923055 GCATATTCTCACTTATATGTGGG - Intergenic
1084228151 11:67730441-67730463 GCATATCCTCTCTTTCATGTGGG + Intergenic
1084245141 11:67851975-67851997 GCATATCCTCTCTTTCATGTGGG + Intergenic
1084261545 11:67982122-67982144 GCATATCCTCTCTTTCATGTGGG + Intergenic
1084807073 11:71586421-71586443 GCATCTCCTCTCTTTCATGTGGG - Intronic
1084811097 11:71611989-71612011 GCATATCCTCTCTTTCATGTGGG - Intergenic
1084827547 11:71742603-71742625 GCATATCCTCTCTTTCATGTGGG - Intergenic
1084844157 11:71886433-71886455 GCATATCCTCTCTTTCATGTGGG - Intronic
1084847015 11:71908891-71908913 GCATATCCCCTCTTTCATGTGGG - Intronic
1084932417 11:72567639-72567661 GTATATTCTCTGTTGCATGTAGG + Intergenic
1086227619 11:84531241-84531263 GCATATTCTCACTTACAGGTGGG + Intronic
1086892344 11:92272521-92272543 TCATATTCTCCCTTTTATGTGGG - Intergenic
1087366556 11:97226939-97226961 GCATATTCTCACTTACAAGTGGG - Intergenic
1088395591 11:109364502-109364524 GCATCTCCTCACTTACAGGTAGG - Intergenic
1089149601 11:116354550-116354572 ACATTTCCTTTCTTTCCTGTTGG - Intergenic
1089203113 11:116737255-116737277 GCATGTCCTCTCTTGTAAGTGGG + Intergenic
1089911268 11:122102928-122102950 GCATCTCCTCTCATTTCTGTTGG + Intergenic
1090685185 11:129109126-129109148 GCATATTCTCACTTACATGTGGG - Intronic
1092415714 12:8289106-8289128 GCATATCCTCTCTTTCATGTGGG + Intergenic
1092432843 12:8422691-8422713 GCATATCCTCTCTTCCATATGGG + Intergenic
1092435431 12:8443320-8443342 GCATATCCTCTCTTTCATGTGGG + Intergenic
1092692082 12:11124323-11124345 ACATCTTCTCTATTTCATGTAGG - Intronic
1093199826 12:16173113-16173135 GCCTCTACTCTCCTTCATGTTGG - Intergenic
1093620928 12:21288120-21288142 GCATGTCCTCACTTACTTGTGGG + Intronic
1096936662 12:55287610-55287632 GCATATTCTCACTTACAAGTGGG + Intergenic
1098789233 12:74799603-74799625 GCATATTCTCACTAACATGTGGG + Intergenic
1099356905 12:81648496-81648518 GAATATCCTCTCATTTATTTAGG - Intronic
1099625200 12:85063767-85063789 GCATATCCTCGCTTATTTGTGGG - Intronic
1099649036 12:85400736-85400758 ACATATGCTTACTTTCATGTGGG - Intergenic
1099783470 12:87230516-87230538 GCAAATTCTCTCTTTTATGCAGG - Intergenic
1099850082 12:88082851-88082873 CCATATCCTCTCTTTAAAATGGG + Intronic
1100521694 12:95381510-95381532 GCATGTCCTCACTTATATGTGGG + Intergenic
1101327536 12:103729115-103729137 GCATGTCCTCACTTACAAGTGGG + Intronic
1104189454 12:126465256-126465278 ACATATGTTCTCATTCATGTTGG - Intergenic
1104292462 12:127482777-127482799 GCATAACCTGTCTTTCATTTGGG - Intergenic
1107204221 13:37762634-37762656 GCATATTCTCACTCACATGTGGG + Intronic
1107544602 13:41424219-41424241 GCATATCCTCTCTTTCATGTGGG + Intergenic
1108612917 13:52101682-52101704 GCATGTCCTCTGCTTCATGGAGG + Intronic
1108999639 13:56781253-56781275 GAAAATTCTCTCTTTGATGTTGG - Intergenic
1109471658 13:62814592-62814614 GCATATTCTCGCTCTTATGTAGG - Intergenic
1109839583 13:67904745-67904767 TCATATCCTCACTTCTATGTAGG + Intergenic
1110290408 13:73799176-73799198 GCATCTTCTCACTTACATGTGGG + Intronic
1111084256 13:83352922-83352944 GCATATTCTCACTTACAGGTGGG + Intergenic
1112538939 13:100287668-100287690 GCATTTCCTTTCTTTTCTGTAGG + Intronic
1112803767 13:103139778-103139800 GCATGTTCTCACTTACATGTCGG + Intergenic
1113584608 13:111456558-111456580 CCATATACACTCTTTTATGTTGG + Intergenic
1114030868 14:18579599-18579621 GCATATATTCTCTTTCTTCTTGG - Intergenic
1115544268 14:34451079-34451101 GCATTTCCTCTCTTTATTATAGG - Intronic
1116673753 14:47878326-47878348 GCATATTCTCACTTACAAGTGGG + Intergenic
1117038358 14:51748995-51749017 GCATATCCTCTCTTTCATGTGGG - Intergenic
1117041153 14:51770218-51770240 TCATATCCTCACTTCTATGTAGG - Intergenic
1119849577 14:77857586-77857608 ACATGTTCTCTCTTACATGTGGG + Intronic
1121696546 14:95917637-95917659 GTATGTCTTCTTTTTCATGTTGG + Intergenic
1121805088 14:96811502-96811524 GCAAATTCTCTCTTCCATCTTGG + Intronic
1122307492 14:100775061-100775083 GCATGTTCTCACTTCCATGTGGG - Intergenic
1124022459 15:25937253-25937275 GCACAACCTCACTTTCATGTTGG + Intergenic
1124022527 15:25937770-25937792 ACACAACCTCACTTTCATGTTGG + Intergenic
1124074918 15:26435161-26435183 GCATGTTCTCTCTTGCATTTTGG + Intergenic
1124502412 15:30240585-30240607 GCATATTCTCACTTACAGGTGGG - Intergenic
1125382142 15:39097668-39097690 GCATATTCTCACTTATATGTGGG - Intergenic
1126741888 15:51785587-51785609 GCATGTTCTCACTTACATGTAGG + Intronic
1127715149 15:61642704-61642726 GAATATCCCCTTTTTCAAGTAGG + Intergenic
1134317350 16:13131380-13131402 GCATATTCTCACTTACAAGTAGG + Intronic
1136486402 16:30574937-30574959 ACATGTCCTCACTTACATGTGGG - Intronic
1137522526 16:49207027-49207049 GACTATCCTCCCTTTCATGGTGG - Intergenic
1138890604 16:61139823-61139845 GCATATTCTCACTTACTTGTGGG - Intergenic
1138998974 16:62485679-62485701 GCATATTCTCTCTTATAAGTGGG + Intergenic
1139048283 16:63090360-63090382 GCATATCCTCACTTACAAGTGGG + Intergenic
1139104822 16:63815842-63815864 TTAGTTCCTCTCTTTCATGTTGG - Intergenic
1140313535 16:73872220-73872242 GGATGTCCTCTCTTTTATATGGG - Intergenic
1140463782 16:75162736-75162758 GCATATCCTCACTTATAAGTGGG - Intronic
1140754930 16:78058618-78058640 GCATATCCTCTCTTTCATTTGGG + Intronic
1141055852 16:80812985-80813007 GTATTTTTTCTCTTTCATGTTGG - Intergenic
1141888932 16:86913567-86913589 GAAAACCCTCTATTTCATGTGGG - Intergenic
1143251984 17:5530186-5530208 GCATATCATCTCTTTCCTGCTGG + Intronic
1145865279 17:28237308-28237330 GCATATCCTGTCTTTCATTTGGG + Intergenic
1150706970 17:67495608-67495630 GCATATTCTCACTTACAAGTGGG - Intronic
1155407294 18:25502980-25503002 ACATGTTCTCTCTTACATGTAGG + Intergenic
1156093200 18:33496465-33496487 TTTTGTCCTCTCTTTCATGTTGG - Intergenic
1156639076 18:39068233-39068255 GCATAACCTCTTTTTAATGGTGG - Intergenic
1156697038 18:39779629-39779651 GGAGATCCTCTCTCTAATGTAGG + Intergenic
1158424446 18:57326420-57326442 GCACATTCCATCTTTCATGTTGG - Intergenic
1159349193 18:67249781-67249803 GCATATTCTCGCTTATATGTGGG - Intergenic
1159384335 18:67703873-67703895 GCATATTCTCACTTACAAGTGGG - Intergenic
1163409274 19:17143516-17143538 GCATGTTCTCACTTTCAAGTGGG + Intronic
1163966785 19:20753606-20753628 GCATATCCTCTCTTTAATTTGGG + Intronic
1165269663 19:34695124-34695146 GCATATTCTCACTTCCATGTGGG + Intergenic
1165367741 19:35379548-35379570 GCATATCCCCATCTTCATGTGGG - Intergenic
1167562044 19:50231819-50231841 CCATATCCTCACTGTCAAGTGGG - Intronic
1167773032 19:51533088-51533110 GCATGTTCTCACTTACATGTGGG - Intergenic
925895916 2:8472018-8472040 GCATATGCACTCTTTCATAGTGG + Intergenic
926440958 2:12888322-12888344 GGCTTTCCTCACTTTCATGTTGG - Intergenic
928069784 2:28203007-28203029 GCACATCCTCTCTTGTGTGTAGG + Intronic
928895002 2:36251150-36251172 GTATTTCTTCTCTTTCATTTAGG - Intergenic
928946907 2:36779691-36779713 GCATGTCCTCACTTACAAGTGGG - Intronic
930169810 2:48239757-48239779 GAATGTTCTCTCTTACATGTGGG + Intergenic
930518095 2:52432723-52432745 GCATACCCCATCTTTCATTTAGG - Intergenic
932349485 2:71020803-71020825 GCATATCCTCTCTTTCATGTGGG - Intergenic
932353063 2:71047283-71047305 GCATAGCCTCTCTTTCATTTGGG - Intergenic
933873108 2:86589444-86589466 GCATGTTCTCTCTTACAAGTGGG - Intronic
933935889 2:87203623-87203645 GCATACCCTGTCTTTCATTTGGG + Intergenic
935404824 2:102698033-102698055 GCATCTGCTCTATTTCGTGTAGG - Intronic
935420028 2:102857652-102857674 TCTTATCCTCGCTTTCTTGTGGG - Intergenic
935435994 2:103033290-103033312 AGATATCCTCTCTGTTATGTTGG - Intergenic
935569939 2:104649105-104649127 GCATAGCCTCACTTGCATTTGGG + Intergenic
935658017 2:105441406-105441428 GTTTTTCCTCTCTTTCATTTTGG - Intergenic
936357259 2:111762207-111762229 GCATACCCTGTCTTTCATTTGGG - Intergenic
937846166 2:126581662-126581684 GCATATCCTCACTTATAAGTGGG + Intergenic
938618463 2:133023673-133023695 GCATATTCTCACTTACAAGTAGG - Intronic
938769582 2:134489759-134489781 TCATATCCTCTCTGTGCTGTGGG - Intronic
938918819 2:135973335-135973357 GCATATTCTCACTTACTTGTGGG + Intronic
938945959 2:136212287-136212309 GCATGTGATCTCTTTCAAGTAGG - Intergenic
939380538 2:141429715-141429737 GCATATTCTCTCTTATAAGTGGG - Intronic
939467148 2:142572338-142572360 GCATGTTCTCACTTACATGTGGG - Intergenic
939649116 2:144740245-144740267 GCATATTCTCACTTACAAGTGGG - Intergenic
939661581 2:144897823-144897845 GCATATCCTCACTCATATGTGGG - Intergenic
940871764 2:158866585-158866607 GCATATCCTCTCTTTCATGTGGG - Intergenic
940873984 2:158882589-158882611 GTATATCCTCTCTTTCATGTGGG - Intergenic
941534958 2:166710931-166710953 GCATGTTCTCACTTACATGTGGG - Intergenic
944201191 2:197108997-197109019 GCATCTCCTCTCTGTCCTGCTGG - Intronic
944864802 2:203849866-203849888 TCATATCCTCTCATTCTTCTTGG - Intergenic
1169820858 20:9708408-9708430 GGATATCCCCTCTGTCAGGTGGG - Intronic
1169837276 20:9894360-9894382 GCATATTCTCATTTACATGTGGG + Intergenic
1170798086 20:19567422-19567444 GCATATTCTCACTTACAAGTGGG + Intronic
1171196520 20:23204081-23204103 GCATATCATTTCTGTCCTGTAGG + Intergenic
1171407466 20:24921237-24921259 GCATATCCTCTCTTTCATTTGGG - Intergenic
1171497703 20:25568744-25568766 TCAGATCATCTCTTTCATCTTGG - Intronic
1171562842 20:26142584-26142606 GAATAGCTTCTCTTTCTTGTTGG + Intergenic
1173348222 20:42220853-42220875 CCGTATCCTCTCTTTAATCTTGG + Intronic
1173357650 20:42309095-42309117 TCATATCCTTTCCATCATGTAGG - Intronic
1173631603 20:44520521-44520543 GCATATTCTCGCTTACAAGTGGG + Intronic
1177382344 21:20361217-20361239 GCATGTCCTCGCTTACTTGTGGG + Intergenic
1177709185 21:24748776-24748798 GCATATTCTCTCTTATTTGTGGG + Intergenic
1177951838 21:27547936-27547958 GGATTTCCTTTCTTTCAAGTGGG + Intergenic
1179470065 21:41604569-41604591 TCATTTCTTCTTTTTCATGTTGG + Intergenic
1180454981 22:15506657-15506679 GCATATATTCTCTTTCTTCTTGG - Intergenic
1181451816 22:23027739-23027761 GCATATCAGCTATTTCATCTGGG - Intergenic
1181882869 22:25995202-25995224 GCATATTCTCACTTACTTGTGGG + Intronic
1184228796 22:43146680-43146702 GCATGTCCTCACTTACAAGTGGG + Intergenic
949157662 3:848317-848339 GCATACCCTGTCTTTCATTTGGG - Intergenic
949882606 3:8673769-8673791 GCATATCCTCTCTTTCACGTGGG - Intronic
949885547 3:8690696-8690718 TCATATCCTCACTTCTATGTAGG + Intronic
950292625 3:11798414-11798436 GCATATTCTCACTTACAAGTAGG + Intronic
956715397 3:72075402-72075424 GCATTTTCTCTCTTGCAAGTGGG + Intergenic
957022067 3:75138176-75138198 GCATACCCTGTCTTTCATTTGGG - Intergenic
957044832 3:75365506-75365528 CCATATCCTCTCTTTCATGTGGG + Intergenic
957076621 3:75607695-75607717 GCATATCCTCTCTTTCATGTGGG + Intergenic
957242726 3:77679612-77679634 GCATATGCTCACTTACAAGTGGG - Intergenic
957684545 3:83484134-83484156 GCGTCTCCTCTCTTACATGTGGG - Intergenic
957880515 3:86206222-86206244 GCATATTCTCACTTACAGGTGGG + Intergenic
958706287 3:97660494-97660516 ACTTATCCTCTCTTTTATCTTGG - Intronic
959771061 3:110096871-110096893 GCATATTCTCACTTACAAGTAGG - Intergenic
959828464 3:110831088-110831110 GCATATTCTCACTTTTAAGTGGG - Intergenic
959898680 3:111635002-111635024 GCTTATCCACTCTATCATTTAGG - Intronic
959981492 3:112522626-112522648 ACATGTCCTCACTTACATGTAGG - Intergenic
961116092 3:124331372-124331394 GCATATTCTCACTTTTAAGTGGG + Intronic
961271833 3:125695261-125695283 GCATATCCTCTCTTTCATGTGGG - Intergenic
961273217 3:125705890-125705912 TCATATCCTCACTTCCATGTAGG + Intergenic
961274672 3:125717487-125717509 GCAACTCCTCTCTTTCATGTGGG - Intergenic
961277593 3:125740119-125740141 GCATCTCCTCTCTTTCATGTGGG - Intergenic
961347855 3:126275734-126275756 GGATCTCCTCTCCTTCAAGTAGG + Intergenic
961398608 3:126616792-126616814 GCAAATCCTCTCATTGATTTGGG - Intronic
961876831 3:130029544-130029566 GCATCTCCTCTCTTTCATGTGGG + Intergenic
961893260 3:130147719-130147741 GCATATCCTCTCTTTCATGTGGG + Intergenic
962042570 3:131722345-131722367 TCAGATCCCCTCTCTCATGTGGG - Intronic
962385492 3:134929263-134929285 GCATATCTTCTCTATGAGGTTGG + Intronic
962671905 3:137716790-137716812 GCATATTCTCACTTACAAGTGGG - Intergenic
965608939 3:170524869-170524891 TCATGTCTTCTCTTTCCTGTTGG - Intronic
966274866 3:178153204-178153226 GCAGATTCTCACTTTCAAGTGGG - Intergenic
968989104 4:3896746-3896768 GCATATCCTCTCTTTCATGTGGG + Intergenic
969020072 4:4133989-4134011 GCATATCCTCTCTTTCATGTGGG + Intergenic
969024780 4:4164390-4164412 GCATATCCTCTCTTTCATGTGGG + Intergenic
969025681 4:4170336-4170358 GAATCTCCTCTCTTTCATGTGGG + Intergenic
969470617 4:7385441-7385463 GGAAGTCCTCTCTTTCATGCGGG + Intronic
969729037 4:8942772-8942794 GCATATCCTCTCTTTCATGTGGG - Intergenic
969733781 4:8973423-8973445 GCATATCCTCTCTTTCATGTGGG - Intergenic
969735173 4:8983955-8983977 TCATATCCTCACTTCTATGTAGG + Intergenic
969749501 4:9099423-9099445 GCATATCCTCTCTTTCATTTGGG - Intergenic
969785211 4:9452307-9452329 GCATATCCTCTCTTTCATGTGGG - Intergenic
969788627 4:9476714-9476736 GCATATCCTCTCTTTCATGTGGG - Intergenic
969793371 4:9507483-9507505 GCATATCCTCTCTTTCATGTGGG - Intergenic
969826253 4:9760849-9760871 GCATATCCTCTGTTTCATGTGGG - Intergenic
970330818 4:14982172-14982194 ACATATCCTCACTTACAGGTGGG + Intergenic
970895544 4:21099379-21099401 GCATGTTCTCACTTTTATGTGGG + Intronic
971012306 4:22451803-22451825 GTATACCTTCTCTTTCAGGTGGG + Intronic
971663833 4:29456503-29456525 GAATATGCTCTGTTACATGTCGG - Intergenic
971877599 4:32325519-32325541 GGATTGCCTCTCTCTCATGTGGG + Intergenic
975563740 4:75732233-75732255 GCATTTCCTCACTTACAAGTGGG - Intronic
976378308 4:84370360-84370382 GCATATTCTCACTTTTAAGTGGG - Intergenic
976485101 4:85592711-85592733 GCATATTCTCTCTTATATGTGGG - Intronic
976991036 4:91366725-91366747 GCATGTCCTTTCTCTCATGCTGG + Intronic
977077938 4:92482232-92482254 GCATGTCCTCACTTATATGTGGG + Intronic
977366290 4:96072477-96072499 GCATATGCTTTCTTTTATTTTGG - Intergenic
978116074 4:105021911-105021933 CAATATCCACTCTTTCATCTAGG - Intergenic
979266861 4:118713678-118713700 CATTATCCTCTCTTTGATGTTGG + Exonic
979435261 4:120680716-120680738 GCATATTCTTACTTACATGTGGG + Intergenic
979511768 4:121562267-121562289 GCATGTCCTCACTTACAAGTGGG - Intergenic
980144669 4:128967082-128967104 GCATGTCCTCACTTACAAGTGGG - Intronic
980168554 4:129258464-129258486 GCATGTTCTCCCTTACATGTGGG + Intergenic
981565851 4:146100541-146100563 GCATGTTCTCACTTACATGTGGG - Intergenic
981604570 4:146527863-146527885 GCATATCCTCTCTTTCATTTGGG - Intergenic
981822951 4:148906991-148907013 GTAAATCATCTCTTTCAAGTTGG + Intergenic
984132147 4:175890948-175890970 GCATATACTCTATATCATTTGGG - Intronic
984728906 4:183047205-183047227 GCATGTTCTTTCTTACATGTAGG + Intergenic
984946411 4:184971986-184972008 GCACAGCCTCTCTTACATGGAGG - Intergenic
986991507 5:13558281-13558303 GCATATTCTCACTCACATGTGGG - Intergenic
987460824 5:18207637-18207659 GCTTTTCCTCTCTTTGATATTGG + Intergenic
987949291 5:24654951-24654973 GCATATTCTCACTTACAGGTGGG - Intergenic
988412894 5:30909996-30910018 GCATATTCTCACTTACAAGTGGG + Intergenic
989267310 5:39490876-39490898 GCATATTCTCCCTTTCATTCTGG - Intergenic
989316478 5:40086033-40086055 ACATGTCCTCACTTACATGTGGG + Intergenic
991287864 5:64999561-64999583 GCATATTCTCACTCACATGTGGG - Intronic
992345785 5:75876335-75876357 GCATGTTCTCTCTTGCAGGTGGG + Intergenic
993389749 5:87304867-87304889 GCATTTCCATTCTTTCCTGTAGG + Intronic
993727797 5:91388443-91388465 GCATATTCTCACTTACAAGTGGG - Intergenic
994045807 5:95308565-95308587 GCCCATCCTCTCTTTCCTGCTGG - Intergenic
994327683 5:98467832-98467854 GAATATTCTCTCTTTTTTGTTGG - Intergenic
995131462 5:108634914-108634936 GCATATCCTCTTTCTCAAGATGG - Intergenic
995992155 5:118253724-118253746 CCATATTCTCTCTTTCAGATTGG + Intergenic
998922769 5:147087696-147087718 GCATATTCTCACTTTCAAATAGG - Intergenic
998925321 5:147117440-147117462 GCATATTCTCACTTACATGTGGG - Intergenic
1000603140 5:163298683-163298705 GCATCTCCTCTCTCTTATTTTGG - Intergenic
1001386799 5:171346152-171346174 GCATGGCCTCACTTACATGTGGG - Intergenic
1001849387 5:174950558-174950580 GCATCTCCTCTCTGCCATCTGGG - Intergenic
1003022731 6:2525531-2525553 GCATATCCTCACTTATATGTGGG + Intergenic
1003254417 6:4461769-4461791 TAATATCTTCTCTTTCCTGTAGG - Intergenic
1003462477 6:6342989-6343011 CCCCATTCTCTCTTTCATGTTGG + Intergenic
1003993043 6:11506782-11506804 GCATATTCTCACTTTTAAGTGGG + Intergenic
1004077017 6:12352940-12352962 GAATATTCTCACTTACATGTGGG - Intergenic
1004955111 6:20720835-20720857 ACATATCCTCACTTACATGTGGG - Intronic
1005595976 6:27379868-27379890 GTATTTCCTTTCTTCCATGTGGG - Intronic
1006614158 6:35313678-35313700 GCATGTTCTCACTTACATGTGGG - Intronic
1008720738 6:54348012-54348034 GCATTTCCTTACTTTCATGTAGG + Intronic
1008893659 6:56526227-56526249 TCAAATCCACTCTTTCATTTTGG + Intronic
1011207207 6:84913001-84913023 GCATAACCTTTCCTTCATGCAGG + Intergenic
1011579109 6:88838613-88838635 GCATATATTTTCTTTTATGTAGG - Intronic
1011928399 6:92676959-92676981 GCATATCCTCACTTATAAGTGGG + Intergenic
1012452401 6:99366450-99366472 GCATGCCATCTCTTTCCTGTTGG - Intergenic
1012775705 6:103491392-103491414 GCATATTCTCACTTACAGGTGGG - Intergenic
1012871411 6:104676969-104676991 GCATGTTCTCACTTACATGTCGG + Intergenic
1014300304 6:119673850-119673872 GCAGATTTTCTCTTTCTTGTAGG + Intergenic
1015006948 6:128294616-128294638 GCATTTCATCTCTATCATTTTGG + Intronic
1015517806 6:134101762-134101784 GCATATCCTCATTAACATGTGGG + Intergenic
1015552150 6:134422873-134422895 GCATTCCGTCTCTTTCATTTTGG - Intergenic
1015679288 6:135786204-135786226 GCATATTCTCACTTACAAGTAGG + Intergenic
1016070243 6:139730153-139730175 GCATGTTCTCTCTTGCAAGTGGG - Intergenic
1017370938 6:153707644-153707666 GCATATTCTCTCTTATAAGTGGG - Intergenic
1020307481 7:6846024-6846046 GCATCTCCTCTCTTTCATGTGGG + Intergenic
1020311955 7:6874850-6874872 GCATATCCTCTCTTTCACGTGGG + Intergenic
1020323486 7:6957216-6957238 GCATATCCTCTCTTTCATTTGGG + Intergenic
1020984909 7:15121046-15121068 GCATGTTCTCACTTACATGTGGG - Intergenic
1022448208 7:30487582-30487604 GCATGTTCTCACTTACATGTGGG - Intergenic
1024056968 7:45666359-45666381 GCATGTTCTCACTTACATGTGGG - Intronic
1024181016 7:46894916-46894938 GCATGTTCTCGCTTTCAAGTGGG - Intergenic
1024296587 7:47848243-47848265 GCATATACTGTATTACATGTAGG - Intronic
1024565145 7:50674431-50674453 GCACATCCTCGCTGTCAGGTAGG - Exonic
1024981965 7:55165033-55165055 GAATATCATTTCTTTCATGCTGG + Intronic
1025119293 7:56286646-56286668 GCATATCCTCACTAGCATTTAGG - Intergenic
1025532564 7:61907570-61907592 GGATATTCACTTTTTCATGTAGG - Intergenic
1025738132 7:64172891-64172913 ATATATCTTCTTTTTCATGTAGG + Intronic
1026265758 7:68794811-68794833 GAATCTCCTTTCTTTCATGTAGG - Intergenic
1027665709 7:81041462-81041484 TCATATTCTCTCTTTTATATTGG + Intergenic
1029078603 7:97954963-97954985 GCATATCCTCTCTTTCGTGTGGG + Intergenic
1029288706 7:99484985-99485007 GCTTATCCTCTCTCTCCTGCAGG + Intronic
1030150400 7:106398768-106398790 TTGTATCCTCTCTTTCATGATGG - Intergenic
1030207469 7:106964924-106964946 TCATATCATCCCTTGCATGTAGG + Intergenic
1030437667 7:109545135-109545157 GCTTATCCTCTCTTTTTGGTGGG + Intergenic
1031179235 7:118393891-118393913 GCATGTCCTCACTTACAGGTGGG + Intergenic
1031481070 7:122279138-122279160 GCATATTCTCTCTTATAGGTGGG - Intergenic
1031925207 7:127632375-127632397 CCATGTCTTCTCTCTCATGTGGG - Intergenic
1033592602 7:142824947-142824969 TAATATCTTCTCTTTCATTTTGG + Intergenic
1034317591 7:150147913-150147935 GCATATCCTCACTTATAAGTGGG + Intergenic
1034775166 7:153819312-153819334 GCATATCCTCACTTATAAGTGGG - Intergenic
1036239408 8:7069516-7069538 GCATATCCCCTCTTTCATGTGGG - Intergenic
1036262484 8:7251609-7251631 GCATCTCCTCTCTTTCATGTGGG + Intergenic
1036304104 8:7587949-7587971 GCATCTCCTCTCTTTCATGTGGG - Intergenic
1036314523 8:7710148-7710170 GCATCTCCTCTCTTTCATGTGGG + Intergenic
1036354959 8:8035941-8035963 GCATCTCCTCTCTTTCATGTAGG - Intergenic
1036372572 8:8173766-8173788 GCATATCCTCTCTTTCATTTGGG - Intergenic
1036521002 8:9491632-9491654 GCATATTCTCATTTGCATGTTGG + Intergenic
1036817380 8:11912409-11912431 GCATATCCTCTCTTTCATGTGGG + Intergenic
1036820341 8:11934989-11935011 GCATATCCTCTCTTTCATGTGGG + Intergenic
1036833778 8:12041604-12041626 GCATATCCTCTCTTTCATGTGGG + Intergenic
1036855622 8:12288169-12288191 GCATATCCTCTCTTTCATGTGGG + Intergenic
1036878331 8:12491875-12491897 GCATATCCTCTCTTTCATTTGGG + Intergenic
1036903941 8:12692012-12692034 GCATATCCTCTCTTCCATGTGGG + Intergenic
1036906412 8:12711682-12711704 GCATATCCCCTCTTTCATGTGGG + Intergenic
1037003899 8:13752786-13752808 CCATAATCTCTCTTTAATGTAGG - Intergenic
1037194569 8:16172584-16172606 TCATATCTACTCTTTCATATTGG + Intronic
1037569068 8:20143221-20143243 GCACCTCCTCCCTTTCATGAGGG + Intergenic
1038158243 8:25011432-25011454 GCAGAACCTCTCTTTCAGGAAGG - Intergenic
1038484293 8:27922649-27922671 GCATATCAGCAGTTTCATGTAGG + Intronic
1038798689 8:30730571-30730593 GCATATCCTCTCTTTCATTTGGG - Intergenic
1039137115 8:34337787-34337809 GCATATTCTCACTTTTAAGTGGG + Intergenic
1039277940 8:35953468-35953490 GCATACCCTGTCTTTCATTTGGG - Intergenic
1040410590 8:47150523-47150545 GCATATCCATTCCTTCATGAAGG - Intergenic
1040642912 8:49361120-49361142 GCATATTCTCACTTATATGTGGG - Intergenic
1041033475 8:53762334-53762356 GTATATCCCTTCATTCATGTAGG - Intronic
1041050527 8:53930389-53930411 TTAAATCCTCTCTTACATGTGGG - Intronic
1042725791 8:71875191-71875213 GCATATTCTCACTTATATGTGGG - Intronic
1042837461 8:73091513-73091535 GCAAAGCCTCTCTCTCATGAGGG - Intronic
1044519098 8:93177164-93177186 GCATGTCCTCTCTTATACGTAGG + Intergenic
1044954361 8:97464231-97464253 GCATATTCTCACTTACAAGTGGG + Intergenic
1047139502 8:122121515-122121537 TCATATTATCTCTATCATGTAGG - Intergenic
1047919837 8:129623476-129623498 GTATGTCCTCTCTTACAAGTAGG - Intergenic
1048534178 8:135276987-135277009 GCATGTCCTCACTTACAAGTGGG - Intergenic
1048923176 8:139248698-139248720 GCATCCCCTCTCATTCCTGTTGG - Intergenic
1049020783 8:139956504-139956526 GCATAGCGTCTCCTTGATGTTGG + Intronic
1050156487 9:2672242-2672264 GCATATTCTCACTTATATGTGGG + Intergenic
1050696232 9:8282382-8282404 GTACATCCTCTCATTCCTGTAGG + Intergenic
1050798625 9:9579927-9579949 GCATATTCTCTCTTATAAGTGGG - Intronic
1052059827 9:23946250-23946272 GCATTTTCTATCTTTCCTGTTGG - Intergenic
1052074930 9:24129908-24129930 GCATGTCCTCACTTGTATGTGGG + Intergenic
1053301121 9:36950365-36950387 GCATTTCCTCTCTTCTATTTTGG - Intronic
1055190225 9:73511103-73511125 GCATGTTCTCACTTACATGTGGG - Intergenic
1055829683 9:80363206-80363228 GCATATTCTCACTTTTAAGTGGG - Intergenic
1056865392 9:90224044-90224066 GCATATCCTCTCTTTCATGTGGG - Intergenic
1056866808 9:90234670-90234692 TCATATCCTCACTTCCATGTAGG + Intergenic
1056917617 9:90758844-90758866 GCATATCCTCTCTTTCATGTGGG + Intergenic
1057001006 9:91509298-91509320 CCATTTTGTCTCTTTCATGTTGG - Intergenic
1057556305 9:96090704-96090726 GCATATCCTCACTTATAAGTGGG - Intergenic
1058346166 9:103965611-103965633 GCATATTCTCACTTATATGTGGG - Intergenic
1059543290 9:115151862-115151884 GCATTTCCTCTGTTTCAACTTGG - Intronic
1060338751 9:122753216-122753238 GCATATTCTCACTTACAAGTGGG - Intergenic
1062224607 9:135442608-135442630 GCATATCCTCTCTTTCATTTGGG + Intergenic
1186002618 X:5030070-5030092 GCCTAGCCTCCCTTTCATTTTGG + Intergenic
1186092512 X:6065029-6065051 GCATATTCTCACTTACAAGTGGG + Intronic
1188082824 X:25865319-25865341 GCATATTCTCACTTATATGTGGG + Intergenic
1188177310 X:27006961-27006983 GCATATTCTCACTCACATGTGGG + Intergenic
1188699763 X:33243800-33243822 GCATGTTCTCACTTACATGTGGG + Intronic
1188816873 X:34726207-34726229 GCATTTTCTCTCTTACAAGTGGG - Intergenic
1188974795 X:36660296-36660318 GCATATTCTCTCTTATCTGTGGG + Intergenic
1189033705 X:37474994-37475016 GCATATTCTCACTTACTTGTGGG + Intronic
1189084336 X:38004688-38004710 GCATATTCTCACTTACTTGTGGG + Intronic
1189217471 X:39338819-39338841 GCATGTTCTCACTTACATGTGGG - Intergenic
1190315331 X:49147002-49147024 GCATACCCTGTCTTTCATTTGGG + Intergenic
1191819670 X:65290768-65290790 ACATATTCTCACTTACATGTAGG + Intergenic
1192064469 X:67866131-67866153 GCATATTCTCTCTTATAAGTGGG - Intergenic
1192729627 X:73790170-73790192 GCATATCAGCTGCTTCATGTAGG - Intergenic
1193128003 X:77890004-77890026 GCATATCCTCACTTACGTGTGGG - Intronic
1193802678 X:85955009-85955031 GCATATCCTCACTTACTTGCGGG + Intronic
1194199683 X:90939158-90939180 GCATATTCTCACTTACAAGTGGG - Intergenic
1194400114 X:93431669-93431691 GCATATCCTCTCTTTCATTTGGG - Intergenic
1194501489 X:94686925-94686947 GCATAGCAACTGTTTCATGTGGG + Intergenic
1194602202 X:95935851-95935873 GCATATTCTCACTCACATGTGGG - Intergenic
1194788830 X:98119789-98119811 GTTTTTCCTCTCTTTGATGTAGG - Intergenic
1195467686 X:105197989-105198011 GCATATTCTCACTTACAAGTGGG - Intronic
1196624947 X:117867838-117867860 ACATATCCTCTATTTTATGATGG - Intergenic
1197514483 X:127408984-127409006 GCATGTCTTCTCTTTGATGAAGG + Intergenic
1199909867 X:152273703-152273725 GCATATTCTCACTTACATGTAGG + Intronic
1200545672 Y:4515575-4515597 GCATATTCTCACTTACAAGTGGG - Intergenic
1200819563 Y:7568566-7568588 GCATGGCCTCACTTACATGTGGG + Intergenic
1200933056 Y:8714622-8714644 GCATACCCTCTTTTTCATTTGGG - Intergenic
1200947928 Y:8864741-8864763 GCATATCCTCTCTTTCATTTGGG - Intergenic