ID: 969733782

View in Genome Browser
Species Human (GRCh38)
Location 4:8973424-8973446
Sequence TGCATATCCTCTCTTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733782_969733785 -3 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733782_969733787 9 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733782_969733790 24 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733790 4:8973471-8973493 TCTCTTGGAAGGATTCAAGAGGG No data
969733782_969733788 13 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733782_969733784 -4 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733782_969733791 25 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733791 4:8973472-8973494 CTCTTGGAAGGATTCAAGAGGGG No data
969733782_969733789 23 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733789 4:8973470-8973492 CTCTCTTGGAAGGATTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733782 Original CRISPR TGCATATCCTCTCTTTCATG TGG (reversed) Intergenic
No off target data available for this crispr