ID: 969733784

View in Genome Browser
Species Human (GRCh38)
Location 4:8973443-8973465
Sequence TGCAAAGGCTAAACCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 26, 1: 25, 2: 18, 3: 8, 4: 61}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733781_969733784 -3 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733776_969733784 13 Left 969733776 4:8973407-8973429 CCCACACCCAGTTGGACCCACAT No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733779_969733784 6 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733773_969733784 27 Left 969733773 4:8973393-8973415 CCAGTTACCAGGAACCCACACCC No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733777_969733784 12 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733775_969733784 20 Left 969733775 4:8973400-8973422 CCAGGAACCCACACCCAGTTGGA No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733772_969733784 28 Left 969733772 4:8973392-8973414 CCCAGTTACCAGGAACCCACACC No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733778_969733784 7 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61
969733782_969733784 -4 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG 0: 26
1: 25
2: 18
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733784 Original CRISPR TGCAAAGGCTAAACCGAGAC AGG Intergenic
901989732 1:13102933-13102955 TGCAAAGCCTAAACCAGTACAGG + Intergenic
901992080 1:13123819-13123841 TGCAAAGCCTAAACCAGTACAGG - Intergenic
902986219 1:20155839-20155861 TGCAAAGGCTAAACCGGTACAGG + Intergenic
904045296 1:27604719-27604741 TGCAAGGGCGAAACCGAGGTCGG - Intergenic
909776117 1:79487537-79487559 TGCAAAGTCTAAACCAAGAAAGG - Intergenic
911973777 1:104466520-104466542 TGCAAAGGCTAAATCGGTATAGG - Intergenic
918306230 1:183249480-183249502 TGCAAAGCCCAATCCAAGACTGG - Exonic
919836140 1:201574785-201574807 TGCAGAGGATAAACAGAGGCAGG - Intergenic
921747363 1:218753408-218753430 TGCAAAGGCTAAATCGGTATAGG - Intergenic
922651925 1:227347961-227347983 TGAAAAGGCAAAACCTAGAATGG - Intergenic
924624175 1:245686248-245686270 TGCAAAGTCTACACCCAGAAGGG + Exonic
1064394914 10:14974128-14974150 TGCAAAGGCTAAACCCAGACAGG - Intronic
1064395968 10:14982258-14982280 TGCAAAGGCTAAACTGAGGCAGG - Intronic
1066389992 10:34970739-34970761 AGCAAAGGCTAAACTGATACAGG + Intergenic
1067242346 10:44507509-44507531 TGCAAAGGCTAACTTGAGCCAGG + Intergenic
1077589418 11:3480180-3480202 TGCAAAGGCTAAACAGAGACAGG - Intergenic
1081264356 11:41001258-41001280 TGAAAAGGGGAAACCGATACTGG - Intronic
1084228148 11:67730421-67730443 TGCAAAGGCTAAAGCGAGACAGG - Intergenic
1084245138 11:67851955-67851977 TGCAAAGGCTAAACAGAGACTGG - Intergenic
1084261542 11:67982102-67982124 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1084791899 11:71480467-71480489 CTCAAAGGCTAAACAGAGCCAGG - Intronic
1084807076 11:71586441-71586463 TGCAAAGGCTAAACCGAGACAGG + Intronic
1084811100 11:71612009-71612031 TGCAAAGGCTAAACCGAGACAGG + Intergenic
1084827550 11:71742623-71742645 TGCAAAGGCTAAACAGAGACAGG + Intergenic
1084844160 11:71886453-71886475 TGCAAAGGCTAAACCGAGACAGG + Intronic
1087434628 11:98099173-98099195 TGCAATGGCTACAAAGAGACTGG - Intergenic
1090880429 11:130827816-130827838 GGCCATGGCTAACCCGAGACAGG - Intergenic
1092308346 12:7324662-7324684 TGTAAAGGCTGAACCAAGAGAGG + Intronic
1092415711 12:8289086-8289108 TGCAAAGGCTAAACAGAGACAGG - Intergenic
1092432840 12:8422671-8422693 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1092435428 12:8443300-8443322 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1097965993 12:65581925-65581947 TGCAAAGTCTACAGAGAGACAGG - Intergenic
1103980628 12:124734762-124734784 TGCAGATGCTAAACCCAGAGGGG + Intergenic
1104292466 12:127482797-127482819 TGCAAAGGCTAAACCGGTACAGG + Intergenic
1106460064 13:29960718-29960740 TGCAAAGACGAAATAGAGACAGG + Intergenic
1106536414 13:30648053-30648075 GGGAAAGGCTAAACAGAGATGGG - Intronic
1112304357 13:98260436-98260458 TGCAAAGGCTAAACTCAGTGAGG - Intronic
1114251980 14:20969485-20969507 TGGAAAGGCCAAGCAGAGACTGG - Intergenic
1117038361 14:51749015-51749037 TGCAAAGGCTAAACCGAGACAGG + Intergenic
1140754927 16:78058598-78058620 TGCAAAGGCTAAACCGATATAGG - Intronic
1141372785 16:83503045-83503067 TACAAAGGCTACACAGAGAGAGG + Intronic
1145865276 17:28237288-28237310 TGCAAAGGCTAAACCGATACAGG - Intergenic
1147193910 17:38752624-38752646 TGCAAAGTCAAAACGGAGGCGGG - Intergenic
1149378477 17:56069362-56069384 AGCAAAGGCTGACCTGAGACTGG + Intergenic
1152137579 17:78513887-78513909 TGCAAAGGATACAGAGAGACAGG - Intronic
1152511493 17:80792629-80792651 TCCAAAGGCTAAACAGATAGTGG + Intronic
1156954520 18:42945433-42945455 TGAAAAGGCAAAACATAGACTGG + Intronic
1159529442 18:69636883-69636905 TGCAAAGGCAAAATGCAGACTGG + Intronic
1162319443 19:9962434-9962456 TGCAAAGGCTCAGTCAAGACAGG - Intronic
1163287133 19:16355853-16355875 TGCAAAGGAAAAACGGAGAGTGG + Intronic
1163342725 19:16720005-16720027 AGCAAAGGCTAAAGAGAGGCTGG + Exonic
1163966782 19:20753586-20753608 TGCAAAGGCTAAACCGATACAGG - Intronic
1164480609 19:28608487-28608509 TGCAAAGGCTAAACTGGTACAGG + Intergenic
930518098 2:52432743-52432765 TGCAAAGGCTAAACTGGTACAGG + Intergenic
931699457 2:64898098-64898120 TGCAAAGGCTAAACCGGTACAGG - Intergenic
932349488 2:71020823-71020845 TGCAAAGGCTAAACCGAGACAGG + Intergenic
933935886 2:87203603-87203625 TGCAAAGGCTAAACCCATACAGG - Intergenic
935687780 2:105699185-105699207 TGCAAAGGCTCATCTGAGATGGG - Intergenic
936357262 2:111762227-111762249 TGCAAAGGCTAAACCGATACAGG + Intergenic
940871767 2:158866605-158866627 TGCAAAGGCTAAACCAAGACAGG + Intergenic
940873988 2:158882609-158882631 TACAAAGGCTACACGGAGACAGG + Intergenic
944463018 2:199971870-199971892 TGCAACGGGTAAACCTTGACTGG - Intronic
947594557 2:231402733-231402755 TGCAAAGGCTAAACCGAGACAGG + Intergenic
1171407469 20:24921257-24921279 TGCAAAGGCTAAACTGATACAGG + Intergenic
1174841567 20:53906030-53906052 TCCAAAGGATGAACTGAGACTGG + Intergenic
1179883183 21:44301890-44301912 TGCACAGACTAAACAGAGAAGGG + Intronic
1185120152 22:48961206-48961228 TGCCAAGGCTAAAGGGAGGCGGG - Intergenic
949157666 3:848337-848359 TGCAAAGGCTAAACCGGTACAGG + Intergenic
949882609 3:8673789-8673811 TGCAAAGGCTAAACTGAGACCGG + Intronic
955201742 3:56857861-56857883 TGCAAAGGCTAAAGCATAACTGG - Intronic
957022071 3:75138196-75138218 TGCAAAGGCTAAACCGGTACAGG + Intergenic
957044828 3:75365486-75365508 TGGAAAGGCTAAACCGAGACAGG - Intergenic
957076618 3:75607675-75607697 TGCAAAGGCTAAACCGAGACAGG - Intergenic
961271836 3:125695281-125695303 TGCAAAGGCTAAATCGAGACAGG + Intergenic
961274675 3:125717507-125717529 TGCAAAGGCTAAACCGAGACAGG + Intergenic
961277596 3:125740139-125740161 TGCAAAGGCTAAACCGAGACAGG + Intergenic
961876828 3:130029524-130029546 TGCAAAGGCTAAACCGAGACAGG - Intergenic
961893257 3:130147699-130147721 TGCAAAGGCTAAACAGAGACAGG - Intergenic
968989101 4:3896726-3896748 TGCACAGGCTAAACCGAGACAGG - Intergenic
969020069 4:4133969-4133991 TGCAAAGGCTAAACCGAGACAGG - Intergenic
969258187 4:6017201-6017223 TCCAAAGGCCAGACAGAGACAGG + Intergenic
969729040 4:8942792-8942814 TGCAAAGGCTAAACCGAGACAGG + Intergenic
969733784 4:8973443-8973465 TGCAAAGGCTAAACCGAGACAGG + Intergenic
969749504 4:9099443-9099465 TGCAAAGGCTAAACCGATACAGG + Intergenic
969785214 4:9452327-9452349 TGCAAAGGCTAAACCGAGACAGG + Intergenic
969788629 4:9476734-9476756 TGCAAATGCTAAACCGAGACAGG + Intergenic
969793374 4:9507503-9507525 TGCAAAGGCTAAACCGAGACAGG + Intergenic
969826256 4:9760869-9760891 TGCAAAGGCTAAACCGAGACAGG + Intergenic
970714097 4:18900138-18900160 TGCAAATGCTAAACTGAGTCTGG + Intergenic
972815156 4:42636864-42636886 TGAAAAGGCTGAACACAGACAGG + Intronic
973572351 4:52253315-52253337 TCCAAAGGCTAAACAGAAATCGG - Intergenic
981604573 4:146527883-146527905 TGCAAAGGCTAAATCGATACAGG + Intergenic
982976078 4:162063124-162063146 TTAAAAGGCTAAACCCAGAAGGG - Intronic
995000883 5:107127687-107127709 TGCAAAGGATTAACAGACACAGG - Intergenic
997150795 5:131492722-131492744 TGCAAAGGCTAAGTGGAGACAGG - Exonic
1001539531 5:172527636-172527658 TGCACAGGCTGACCTGAGACAGG - Intergenic
1004189606 6:13452177-13452199 TGCAATGCCTGACCCGAGACTGG + Intronic
1004589934 6:17040617-17040639 TGTAAAGACTAAATGGAGACAGG - Intergenic
1004925135 6:20409059-20409081 GGCAAAGCCAAAACCGAAACGGG + Intronic
1008059495 6:46982583-46982605 TGCAAAGGTGAAAGAGAGACTGG + Intergenic
1008578947 6:52888269-52888291 TCCAAAGGCCAGACCAAGACTGG + Intronic
1011065701 6:83323165-83323187 TGGAAAGGAAAAACCGGGACAGG + Intronic
1012612114 6:101229880-101229902 TGCAAAGGCTAAACCGGTACAGG - Intergenic
1020307478 7:6846004-6846026 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1020311952 7:6874830-6874852 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1020323483 7:6957196-6957218 TGCAAAGGCTAAACCGATACAGG - Intergenic
1029078600 7:97954943-97954965 TGCAAAGGCTAAACTGAGACAGG - Intergenic
1030798810 7:113823950-113823972 TGAAAAGGCTAAATGTAGACAGG + Intergenic
1034344984 7:150380444-150380466 TGCACAGGTTAAACAGAGAAGGG + Intronic
1036239410 8:7069536-7069558 TGCAAAGTCTAAACTGAGACAGG + Intergenic
1036262481 8:7251589-7251611 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1036304107 8:7587969-7587991 TGCAAAGGCTAAACCGAGACAGG + Intergenic
1036314520 8:7710128-7710150 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1036354961 8:8035961-8035983 TGCAAAGGCTAAACCGAGACAGG + Intergenic
1036372575 8:8173786-8173808 TGCAAAGGCTAAACCGATACAGG + Intergenic
1036817042 8:11910078-11910100 TGCAAAGGCTAAGCTGAGACAGG - Intergenic
1036833775 8:12041584-12041606 TGCAAAGGTGAAACCGAGACAGG - Intergenic
1036855619 8:12288149-12288171 TGCAAAGGTGAAACCGAGACAGG - Intergenic
1036878329 8:12491855-12491877 TGCAAACGCTAAACCGAGACAGG - Intergenic
1036903938 8:12691992-12692014 TGCCAAGGCTAAACCGAGACAGG - Intergenic
1036906409 8:12711662-12711684 TGCAAAGGCTCAACTGAGACAGG - Intergenic
1037747117 8:21654569-21654591 TTCAAAGGAGAAACAGAGACTGG - Intergenic
1038798692 8:30730591-30730613 TGCAAAGGCTAAACCGATACAGG + Intergenic
1039277944 8:35953488-35953510 TGCAAAGGCTAAACTGGTACAGG + Intergenic
1044302445 8:90601167-90601189 TGCACAGGCTACACAGAGAAAGG + Intergenic
1056865395 9:90224064-90224086 TGCAAAGGCTAAACCGAGATAGG + Intergenic
1056917614 9:90758824-90758846 TGCAAAGGCTAAACCGAGACAGG - Intergenic
1062224602 9:135442588-135442610 TGCAAAGGCTAAAGGGAGACAGG - Intergenic
1062338613 9:136083599-136083621 TGCAGAGGCCAGGCCGAGACTGG + Intronic
1186662652 X:11684706-11684728 TGCAAAGACTAAACCCAGCTTGG - Intergenic
1187490903 X:19750415-19750437 TGCAGAGGCTAAACTGGGAGGGG - Intronic
1187562813 X:20418576-20418598 GGCCAAAGCTAAACCCAGACAGG - Intergenic
1190315327 X:49146982-49147004 TGCAAAGGCTAAACTGGTAGAGG - Intergenic
1194400117 X:93431689-93431711 TGCAAAGGCTAAACCGATACAGG + Intergenic
1196283596 X:113853381-113853403 GGCAAAGACTAAACCGGGAGTGG - Intergenic
1196520775 X:116668243-116668265 TGCAAGGGCAAGACTGAGACTGG - Intergenic
1200947931 Y:8864761-8864783 TGCAAAGGCTAAACTGATACAGG + Intergenic
1202036888 Y:20645204-20645226 TGCAAAGCCTAAACAGGTACAGG + Intergenic