ID: 969733785

View in Genome Browser
Species Human (GRCh38)
Location 4:8973444-8973466
Sequence GCAAAGGCTAAACCGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 26, 1: 23, 2: 21, 3: 13, 4: 244}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733772_969733785 29 Left 969733772 4:8973392-8973414 CCCAGTTACCAGGAACCCACACC No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733781_969733785 -2 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733773_969733785 28 Left 969733773 4:8973393-8973415 CCAGTTACCAGGAACCCACACCC No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733776_969733785 14 Left 969733776 4:8973407-8973429 CCCACACCCAGTTGGACCCACAT No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733775_969733785 21 Left 969733775 4:8973400-8973422 CCAGGAACCCACACCCAGTTGGA No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733777_969733785 13 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733778_969733785 8 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733779_969733785 7 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244
969733782_969733785 -3 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG 0: 26
1: 23
2: 21
3: 13
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733785 Original CRISPR GCAAAGGCTAAACCGAGACA GGG Intergenic
900292085 1:1927966-1927988 CCAGAGGATAAACCGAGGCACGG + Intronic
901594580 1:10374674-10374696 GCAAAAGCGAAACCGTGCCATGG - Intronic
901777763 1:11572170-11572192 GCCAAGTCTATCCCGAGACATGG - Intergenic
901989733 1:13102934-13102956 GCAAAGCCTAAACCAGTACAGGG + Intergenic
901992079 1:13123818-13123840 GCAAAGCCTAAACCAGTACAGGG - Intergenic
902986220 1:20155840-20155862 GCAAAGGCTAAACCGGTACAGGG + Intergenic
903813185 1:26046105-26046127 GCAGCGGCTGACCCGAGACACGG - Exonic
904764452 1:32833151-32833173 GCAAAGGCTAAACGGTCACTTGG - Intronic
906373033 1:45270469-45270491 CCAAAGTCTCATCCGAGACAAGG - Intronic
906655221 1:47543305-47543327 CCAAAGTCTCATCCGAGACAAGG - Intergenic
907556002 1:55344686-55344708 GCAAAGTCTCATCTGAGACAAGG - Intergenic
907616667 1:55933522-55933544 CCAAAGGCTCATCTGAGACAAGG + Intergenic
908620747 1:65976421-65976443 CCAAAGTCTAATCTGAGACAAGG - Intronic
908963423 1:69729336-69729358 CCAAAGTCTAATCTGAGACAAGG + Intronic
908970573 1:69824234-69824256 GAAAAAGCTAAACGGAGAAAAGG + Intronic
909376866 1:74950994-74951016 CCAAAGTCTCAGCCGAGACAAGG - Intergenic
911973776 1:104466519-104466541 GCAAAGGCTAAATCGGTATAGGG - Intergenic
915804257 1:158828273-158828295 GCAAAGTCTCATCCAAGACAAGG + Intergenic
916394513 1:164371070-164371092 GCAAAGGCTAAAATGACAGATGG + Intergenic
917082736 1:171272835-171272857 CCAAAGTCTCAACTGAGACATGG - Intronic
917380787 1:174405412-174405434 TCAAAGCCTACACCTAGACAAGG - Intronic
918167527 1:181964778-181964800 CCAAAGTCTAATCTGAGACAAGG + Intergenic
919055882 1:192569478-192569500 CCAAAGTCTCATCCGAGACAAGG + Intergenic
919836139 1:201574784-201574806 GCAGAGGATAAACAGAGGCAGGG - Intergenic
921747362 1:218753407-218753429 GCAAAGGCTAAATCGGTATAGGG - Intergenic
923876763 1:238058188-238058210 TCAAAGTCTAATCTGAGACAAGG + Intergenic
1064344711 10:14521641-14521663 GCAAAAGCAAAACAGGGACATGG - Intronic
1064394913 10:14974127-14974149 GCAAAGGCTAAACCCAGACAGGG - Intronic
1064395967 10:14982257-14982279 GCAAAGGCTAAACTGAGGCAGGG - Intronic
1064397667 10:14994443-14994465 GCAAAGGCTAAACCGACACAAGG - Intergenic
1066389993 10:34970740-34970762 GCAAAGGCTAAACTGATACAGGG + Intergenic
1067839952 10:49667569-49667591 GCAAAGGCAACACTGAGCCATGG + Intergenic
1070747595 10:78944013-78944035 GCCAAGGCTAAAGAGAGAGAAGG + Intergenic
1071211985 10:83352632-83352654 GCCAAGGGTAAACAGAGAAAGGG + Intergenic
1071361351 10:84849430-84849452 GCAAAGGCAAAAAGGAGACAAGG - Intergenic
1072548848 10:96461603-96461625 GCAGAGGCTAAACAAAGGCATGG - Intronic
1072866405 10:99066884-99066906 CCAAAGTCTCAACTGAGACAAGG + Intronic
1075285829 10:121185011-121185033 GAACACGCTAAACAGAGACATGG + Intergenic
1075530240 10:123222996-123223018 GTGAAGGCTTAACCGAGATAAGG - Intergenic
1075937888 10:126359354-126359376 CCAAAGTCTCATCCGAGACAAGG + Intronic
1077589417 11:3480179-3480201 GCAAAGGCTAAACAGAGACAGGG - Intergenic
1079736221 11:23999972-23999994 GCCATGGCTAAAACGAGTCAAGG - Intergenic
1079750457 11:24190503-24190525 GCAAAGTCTTATCTGAGACAAGG + Intergenic
1080449646 11:32368357-32368379 CCAAAGTCTCAACTGAGACAAGG + Intergenic
1081167006 11:39819561-39819583 CCAAAGTCTAATCTGAGACAAGG + Intergenic
1082118923 11:48357293-48357315 CCAAAGTCTAACCTGAGACAAGG + Intergenic
1082255378 11:50027856-50027878 CCAAAGTCTAATCTGAGACAAGG - Intergenic
1084228147 11:67730420-67730442 GCAAAGGCTAAAGCGAGACAGGG - Intergenic
1084245137 11:67851954-67851976 GCAAAGGCTAAACAGAGACTGGG - Intergenic
1084261541 11:67982101-67982123 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1084807077 11:71586442-71586464 GCAAAGGCTAAACCGAGACAGGG + Intronic
1084811101 11:71612010-71612032 GCAAAGGCTAAACCGAGACAGGG + Intergenic
1084827551 11:71742624-71742646 GCAAAGGCTAAACAGAGACAGGG + Intergenic
1084844161 11:71886454-71886476 GCAAAGGCTAAACCGAGACAGGG + Intronic
1085822399 11:79806716-79806738 GCAGAGGCAAAAAGGAGACAAGG - Intergenic
1086376842 11:86209619-86209641 GCAAGGACTAAACCTAGACCTGG - Intergenic
1091600938 12:1917354-1917376 GCAAAGGCTAAGCACAGGCACGG + Intronic
1092265066 12:6974525-6974547 GCAAAGCAGAAACCGAGACATGG - Intronic
1092415710 12:8289085-8289107 GCAAAGGCTAAACAGAGACAGGG - Intergenic
1092432839 12:8422670-8422692 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1092435427 12:8443299-8443321 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1093037954 12:14351206-14351228 CCAAAGCCTAATCTGAGACAAGG + Intergenic
1094762662 12:33551966-33551988 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1095544053 12:43344452-43344474 CCAAAGTCTAATCTGAGACAAGG + Intergenic
1095689186 12:45068527-45068549 GCAAAGTCTTATCTGAGACAAGG + Intergenic
1097668741 12:62512266-62512288 CCAAAGGCTCAACTGAGACAAGG + Intronic
1097999206 12:65922575-65922597 CCAAAGTCTAATCTGAGACAAGG - Intronic
1099076216 12:78112846-78112868 CCAAAGTCTAATCTGAGACAAGG + Intronic
1099694189 12:85997467-85997489 CCAAAGTCTCATCCGAGACAAGG + Intronic
1099932735 12:89092223-89092245 CCAAAGTCTTATCCGAGACAAGG - Intergenic
1100054464 12:90491595-90491617 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1101192950 12:102353945-102353967 CCAAAGGCTCATCTGAGACAAGG + Intergenic
1101505556 12:105342962-105342984 GTAAAAGCTAAACAGAGCCAAGG + Intronic
1101999947 12:109551068-109551090 GCAGAGGCAAAGCCAAGACAAGG - Intergenic
1103911167 12:124353236-124353258 GCAAAGGGGAAACGGAGTCAGGG + Intronic
1104292467 12:127482798-127482820 GCAAAGGCTAAACCGGTACAGGG + Intergenic
1105541229 13:21319223-21319245 GCAAAGGCAAAAGCAAGAAATGG + Intergenic
1106338594 13:28807123-28807145 GTCATGGCTAAACAGAGACAAGG + Intergenic
1106383617 13:29263997-29264019 CCAAAGGCTCATCTGAGACAAGG + Intronic
1106460065 13:29960719-29960741 GCAAAGACGAAATAGAGACAGGG + Intergenic
1106536413 13:30648052-30648074 GGAAAGGCTAAACAGAGATGGGG - Intronic
1108379015 13:49839286-49839308 GCAAAGGCTGAGAGGAGACAAGG - Intergenic
1108603805 13:52017270-52017292 CCAAAGTCTCATCCGAGACAAGG - Intronic
1108790780 13:53966910-53966932 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1108934062 13:55865047-55865069 CCAAAGTCTAATCTGAGACAAGG - Intergenic
1109252034 13:60031535-60031557 GCAAAGTCTCATCTGAGACAAGG + Intronic
1109906337 13:68846597-68846619 CCAAAGCCTCAACTGAGACAAGG - Intergenic
1114843249 14:26290879-26290901 CCAAAGGCTCATCTGAGACAAGG + Intergenic
1115009180 14:28523132-28523154 GCAAAGTCTAATCTGAGACAAGG - Intergenic
1115085693 14:29512683-29512705 ACAAAGTCTAATCTGAGACAAGG + Intergenic
1116122515 14:40738033-40738055 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1116522827 14:45870748-45870770 TCAAAGTCTCATCCGAGACAAGG + Intergenic
1117038362 14:51749016-51749038 GCAAAGGCTAAACCGAGACAGGG + Intergenic
1117427814 14:55619937-55619959 CCAAAGTCTCATCCGAGACAAGG + Intronic
1119963197 14:78882697-78882719 CCAAAGTCTCATCCGAGACAAGG - Intronic
1121482412 14:94289266-94289288 GCAGAGGCAAAACCCAAACAAGG - Intronic
1202863889 14_GL000225v1_random:103376-103398 CAATAGGCTAAACCTAGACAAGG - Intergenic
1125844038 15:42834436-42834458 GCCAAGGCTTAACGGAGAAATGG + Intronic
1125881486 15:43199550-43199572 CCAAAGTCTCACCCGAGACAAGG - Intronic
1127791178 15:62399841-62399863 CCAAAGTCTAATCTGAGACAAGG - Intronic
1129620289 15:77137705-77137727 CCAAAGTCTCATCCGAGACAAGG - Intronic
1131743555 15:95420814-95420836 GCAAAGTCTCAATGGAGACAAGG + Intergenic
1133653875 16:7840430-7840452 GCAAAGGCTAATGAGAGCCACGG - Intergenic
1135275974 16:21113017-21113039 GCAAAGTCTCATCTGAGACAAGG - Intronic
1140754926 16:78058597-78058619 GCAAAGGCTAAACCGATATAGGG - Intronic
1141305996 16:82864831-82864853 CCAAAGTCTCAACTGAGACAAGG + Intronic
1141372786 16:83503046-83503068 ACAAAGGCTACACAGAGAGAGGG + Intronic
1143375039 17:6462363-6462385 GCAAAGGCAGAGCAGAGACATGG - Intronic
1145865275 17:28237287-28237309 GCAAAGGCTAAACCGATACAGGG - Intergenic
1146451834 17:32980995-32981017 CCAAAGTCTAATCTGAGACAAGG + Intronic
1146783960 17:35702317-35702339 GCAAAGACTCAAAGGAGACAGGG + Intronic
1148854143 17:50569525-50569547 GGCAAGGCTACCCCGAGACAAGG - Intronic
1149064765 17:52466352-52466374 CCAAAGGCTCATCTGAGACAAGG - Intergenic
1151692836 17:75697433-75697455 GCAAAGGTGAAACCCAGATATGG - Intronic
1152302866 17:79505577-79505599 GGAAAAGCCAAACTGAGACATGG + Intronic
1154277396 18:12974345-12974367 GCAAAGGTTGAAGCGAGCCAAGG - Intronic
1156265809 18:35487779-35487801 CCAAAGTCTCATCCGAGACAAGG + Intronic
1161467438 19:4439389-4439411 GCAAGTGCTAAACACAGACACGG - Intronic
1162319442 19:9962433-9962455 GCAAAGGCTCAGTCAAGACAGGG - Intronic
1164480610 19:28608488-28608510 GCAAAGGCTAAACTGGTACAGGG + Intergenic
1165248140 19:34509672-34509694 CCAAAGTCTAATCTGAGACAAGG + Exonic
1166263780 19:41663610-41663632 CCAAAGTCTCAACTGAGACAAGG + Intronic
1166410139 19:42551193-42551215 CCAAAGTCTCATCCGAGACAAGG - Intronic
926008439 2:9390359-9390381 GCAAAGGCTAGGCCTAGAAATGG - Intronic
926647447 2:15304978-15305000 CCAAAGGCTTATCTGAGACAAGG - Intronic
927517182 2:23679089-23679111 GCAAAGGTGAAACCAACACAGGG + Intronic
928812589 2:35247548-35247570 GCAAAGTCTCATCTGAGACAAGG + Intergenic
929020232 2:37546089-37546111 TCAAAGTCTCATCCGAGACAAGG + Intergenic
929081705 2:38128212-38128234 CCAAAGTCTAATCGGAGACAAGG - Intergenic
930518099 2:52432744-52432766 GCAAAGGCTAAACTGGTACAGGG + Intergenic
931699456 2:64898097-64898119 GCAAAGGCTAAACCGGTACAGGG - Intergenic
932349489 2:71020824-71020846 GCAAAGGCTAAACCGAGACAGGG + Intergenic
933935885 2:87203602-87203624 GCAAAGGCTAAACCCATACAGGG - Intergenic
936357263 2:111762228-111762250 GCAAAGGCTAAACCGATACAGGG + Intergenic
936549889 2:113427905-113427927 CCAAAGTCTCATCCGAGACAAGG - Intergenic
936959240 2:118056128-118056150 GCAAAGGTTAAAGCCAGTCAAGG + Intergenic
938419635 2:131134354-131134376 GCAAAAGCACAACCGAGAAAAGG - Intronic
940499728 2:154478631-154478653 CCAAAGGCTCATCTGAGACAAGG - Intergenic
940660208 2:156535945-156535967 GCTAAGCCTAAACTGAGACCAGG - Intronic
940871768 2:158866606-158866628 GCAAAGGCTAAACCAAGACAGGG + Intergenic
940873989 2:158882610-158882632 ACAAAGGCTACACGGAGACAGGG + Intergenic
942649699 2:178154094-178154116 GCAAAGTCTCATCCAAGACAAGG + Intergenic
943205205 2:184886029-184886051 CCAAAGTCTCAACTGAGACAAGG + Intronic
944808966 2:203309325-203309347 CCAAAGTCTCAACTGAGACAAGG - Intergenic
947594558 2:231402734-231402756 GCAAAGGCTAAACCGAGACAGGG + Intergenic
948856078 2:240731284-240731306 GCACAGACTAAACAGAGGCAGGG + Intronic
1169322445 20:4644787-4644809 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1169581036 20:7023301-7023323 GCAAAGTCTAATCTGAGACAAGG - Intergenic
1169857898 20:10123638-10123660 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1170310170 20:14983276-14983298 CCAAAGTCTCAACTGAGACAAGG - Intronic
1171407470 20:24921258-24921280 GCAAAGGCTAAACTGATACAGGG + Intergenic
1175985333 20:62761612-62761634 GCAAAGGCTGCTCTGAGACAGGG - Exonic
1182813592 22:33138406-33138428 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1182919656 22:34067588-34067610 GCTGAGGCTAAACAGAGTCAGGG + Intergenic
1183991036 22:41597175-41597197 GCAAAGGGTGAACCGAGGCTTGG + Intergenic
1184338982 22:43875152-43875174 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1184507327 22:44912214-44912236 CCAAAGTCTCATCCGAGACAAGG - Intronic
949369329 3:3317818-3317840 GCAAAGTCTTATCCAAGACAAGG + Intergenic
949882610 3:8673790-8673812 GCAAAGGCTAAACTGAGACCGGG + Intronic
951795684 3:26535630-26535652 GAAAAGGCAAAACTTAGACAAGG + Intergenic
952397186 3:32931156-32931178 CCAAAGTCTCATCCGAGACAAGG - Intergenic
954605588 3:51906746-51906768 CCAAAGTCTCATCCGAGACAAGG - Intergenic
957022072 3:75138197-75138219 GCAAAGGCTAAACCGGTACAGGG + Intergenic
957044827 3:75365485-75365507 GGAAAGGCTAAACCGAGACAGGG - Intergenic
957076617 3:75607674-75607696 GCAAAGGCTAAACCGAGACAGGG - Intergenic
957759304 3:84533799-84533821 CCAAAGTCTCATCCGAGACAAGG - Intergenic
958133185 3:89455732-89455754 GCAAAGGAGAATCTGAGACAAGG - Intronic
958543537 3:95510682-95510704 CCAAAGTCTAATCTGAGACAAGG - Intergenic
959317130 3:104822564-104822586 CCAAAGTCTCAACTGAGACAAGG - Intergenic
959777683 3:110188184-110188206 GCAAAGTCTGATCTGAGACAAGG + Intergenic
961271837 3:125695282-125695304 GCAAAGGCTAAATCGAGACAGGG + Intergenic
961274676 3:125717508-125717530 GCAAAGGCTAAACCGAGACAGGG + Intergenic
961277597 3:125740140-125740162 GCAAAGGCTAAACCGAGACAGGG + Intergenic
961876827 3:130029523-130029545 GCAAAGGCTAAACCGAGACAGGG - Intergenic
961893256 3:130147698-130147720 GCAAAGGCTAAACAGAGACAGGG - Intergenic
965057715 3:163743834-163743856 TCAAAGTCTCAACTGAGACAAGG + Intergenic
965075017 3:163964650-163964672 GCAAAGTCTCACCTGAGACAAGG - Intergenic
966115789 3:176458885-176458907 GCAAAGTCTCATCAGAGACAAGG - Intergenic
968354479 3:198093639-198093661 CCAAAGTCTAATCTGAGACAAGG + Intergenic
968767280 4:2479262-2479284 CCAAAGTCTCATCCGAGACAAGG - Intronic
968989100 4:3896725-3896747 GCACAGGCTAAACCGAGACAGGG - Intergenic
969020068 4:4133968-4133990 GCAAAGGCTAAACCGAGACAGGG - Intergenic
969025678 4:4170315-4170337 TCAAAGGCTAAACTGAGACAAGG - Intergenic
969729041 4:8942793-8942815 GCAAAGGCTAAACCGAGACAGGG + Intergenic
969733785 4:8973444-8973466 GCAAAGGCTAAACCGAGACAGGG + Intergenic
969749505 4:9099444-9099466 GCAAAGGCTAAACCGATACAGGG + Intergenic
969785215 4:9452328-9452350 GCAAAGGCTAAACCGAGACAGGG + Intergenic
969788630 4:9476735-9476757 GCAAATGCTAAACCGAGACAGGG + Intergenic
969793375 4:9507504-9507526 GCAAAGGCTAAACCGAGACAGGG + Intergenic
969826257 4:9760870-9760892 GCAAAGGCTAAACCGAGACAGGG + Intergenic
970157135 4:13152900-13152922 TCAAAGGCTCATCCAAGACAAGG + Intergenic
970361353 4:15311479-15311501 GCAAAGTCTCATCTGAGACAAGG - Intergenic
971336802 4:25730646-25730668 GCAAAGTCAAAACCAAGAGAAGG - Intergenic
971875420 4:32301620-32301642 CCAAAGTCTCAACTGAGACAAGG - Intergenic
973078511 4:45961465-45961487 GCAAAGTCTCATCTGAGACAAGG + Intergenic
973232034 4:47851278-47851300 GTAAATGCTATACTGAGACAAGG + Intronic
974477945 4:62407035-62407057 CCAAAGTCTCATCCGAGACAAGG - Intergenic
974556639 4:63459959-63459981 GCAAAGTCTTATCTGAGACAAGG + Intergenic
974724270 4:65778252-65778274 CCAAAGTCTTACCCGAGACAAGG - Intergenic
974925355 4:68291769-68291791 CCAAAGTCTAATCTGAGACAAGG + Intergenic
975454444 4:74573840-74573862 TCAAAGGCTATACCAAGACATGG + Intergenic
975972514 4:80058516-80058538 ACAAAGGCCAAAACAAGACAGGG + Intronic
977395668 4:96468195-96468217 ACAAAGTCTCATCCGAGACAAGG + Intergenic
978402910 4:108349776-108349798 GCAAAGGCAAAACAGAGGAACGG - Intergenic
978809852 4:112837887-112837909 GCAAAGTCTAATCTGAGACAAGG - Intronic
978904153 4:113986071-113986093 TCAAAGTCTCAACTGAGACAAGG - Intergenic
979885759 4:126025538-126025560 CCAAAGTCTCAACTGAGACAAGG - Intergenic
980707523 4:136519469-136519491 CCAAAGTCTAATCCGAGACAAGG + Intergenic
981260156 4:142709256-142709278 CCAAAGTCTAATCTGAGACAAGG - Intronic
981604574 4:146527884-146527906 GCAAAGGCTAAATCGATACAGGG + Intergenic
981641702 4:146951369-146951391 GCAAAGGCTACACAGAATCAGGG + Intergenic
984353127 4:178621479-178621501 CCAAAGGCCCAACTGAGACAAGG + Intergenic
985371820 4:189292944-189292966 GCAAAGTCTCATCTGAGACAAGG - Intergenic
985536992 5:471083-471105 GCACAGGCTAAACACAAACACGG - Exonic
987722995 5:21662981-21663003 CCAAAGTCTAATCTGAGACAAGG + Intergenic
988724878 5:33916582-33916604 CCAAAGGCTTATCTGAGACAAGG - Intergenic
988928935 5:36016393-36016415 CCAAAGGCTCATCTGAGACAAGG - Intergenic
989218212 5:38926831-38926853 CCAAAGTCTAATCTGAGACAAGG + Intronic
989440480 5:41465980-41466002 GCAAAGGATAAAGTGAGAAAAGG - Intronic
989604545 5:43231427-43231449 GCAGGGGCTAAACCAAGAGATGG - Intronic
990821601 5:59846736-59846758 GCAAAGGCTGAAACGTCACATGG + Intronic
991970125 5:72132925-72132947 GCAAATGCTGAACCTGGACAGGG - Intronic
993575246 5:89591765-89591787 CCAAAGTCTCAACTGAGACAAGG - Intergenic
994494050 5:100488087-100488109 CCAAAGTCTCATCCGAGACAAGG + Intergenic
995667079 5:114554579-114554601 GCAAAGTCTCATCCAAGACAAGG + Intergenic
996897741 5:128504724-128504746 CCAAAGTCTAATCTGAGACAAGG - Intronic
996911483 5:128661264-128661286 CCAAAGTCTAATCTGAGACAAGG - Intronic
999069547 5:148729455-148729477 GCATGGGCTATACCAAGACAGGG - Intergenic
1002180937 5:177430887-177430909 GCAAAGGCAAAAGCAAGAAATGG + Exonic
1003540825 6:7016657-7016679 GCAGAGCCTAAACCAAGATAGGG + Intergenic
1004584764 6:16988774-16988796 GCAAAGGCTAGAAAGAGGCAAGG + Intergenic
1008517901 6:52335420-52335442 TCAGAGACTAAACAGAGACAGGG + Intergenic
1008756227 6:54797899-54797921 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1009763466 6:68038390-68038412 CCAAAGGCTCATCTGAGACAAGG + Intergenic
1011171041 6:84504490-84504512 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1011461858 6:87613549-87613571 CCAAAGTCTCATCCGAGACAAGG + Intronic
1012029295 6:94037645-94037667 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1012612113 6:101229879-101229901 GCAAAGGCTAAACCGGTACAGGG - Intergenic
1013863240 6:114661144-114661166 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1016649505 6:146447921-146447943 GCAAAGTCTTATCTGAGACAAGG + Intergenic
1018952413 6:168387727-168387749 ACAGAGGCTAAACAGAGAGAAGG - Intergenic
1020307477 7:6846003-6846025 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1020311951 7:6874829-6874851 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1020323482 7:6957195-6957217 GCAAAGGCTAAACCGATACAGGG - Intergenic
1023060579 7:36322293-36322315 CCAAAGTCTCATCCGAGACAAGG - Intergenic
1028959507 7:96732918-96732940 GGAAAGGCTGAACCCAGAAATGG + Intergenic
1029078599 7:97954942-97954964 GCAAAGGCTAAACTGAGACAGGG - Intergenic
1030108396 7:106006397-106006419 CCAAAGTCTCATCCGAGACAAGG + Intronic
1032476349 7:132213978-132214000 GCAAAGGAGAAACTGAGGCAAGG + Intronic
1032519037 7:132528739-132528761 GCAATGGCTGAACAGAGAGAAGG + Intronic
1034212071 7:149372746-149372768 TCAAAGTCTCACCCGAGACAAGG + Intergenic
1035549378 8:508812-508834 CCAAAGTCTAATCTGAGACAAGG + Intronic
1036239411 8:7069537-7069559 GCAAAGTCTAAACTGAGACAGGG + Intergenic
1036262480 8:7251588-7251610 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1036304108 8:7587970-7587992 GCAAAGGCTAAACCGAGACAGGG + Intergenic
1036314519 8:7710127-7710149 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1036354962 8:8035962-8035984 GCAAAGGCTAAACCGAGACAGGG + Intergenic
1036372576 8:8173787-8173809 GCAAAGGCTAAACCGATACAGGG + Intergenic
1036655819 8:10676640-10676662 CTAAAGGCTAGAGCGAGACATGG + Intronic
1036817041 8:11910077-11910099 GCAAAGGCTAAGCTGAGACAGGG - Intergenic
1036833774 8:12041583-12041605 GCAAAGGTGAAACCGAGACAGGG - Intergenic
1036855618 8:12288148-12288170 GCAAAGGTGAAACCGAGACAGGG - Intergenic
1036878328 8:12491854-12491876 GCAAACGCTAAACCGAGACAGGG - Intergenic
1036903937 8:12691991-12692013 GCCAAGGCTAAACCGAGACAGGG - Intergenic
1036906408 8:12711661-12711683 GCAAAGGCTCAACTGAGACAGGG - Intergenic
1037239995 8:16766335-16766357 GCAAAGGAAATACAGAGACAGGG - Intergenic
1038798693 8:30730592-30730614 GCAAAGGCTAAACCGATACAGGG + Intergenic
1039277945 8:35953489-35953511 GCAAAGGCTAAACTGGTACAGGG + Intergenic
1041955372 8:63553504-63553526 ACAAAGTCTCATCCGAGACAAGG + Intergenic
1042073835 8:64967051-64967073 GCAAAGTCTCATCTGAGACAAGG + Intergenic
1043263599 8:78232863-78232885 ACAAAGGCTAAAGCAAGAAAAGG + Intergenic
1043918564 8:85953299-85953321 GCAAATGGTAAACTGAGTCAGGG - Intergenic
1044220336 8:89662848-89662870 CCAAAGTCTAATCTGAGACAAGG + Intergenic
1044269509 8:90224904-90224926 GCAAAGGTTAAACCAGAACATGG + Intergenic
1044887350 8:96793680-96793702 CCAAAGTCTCATCCGAGACAAGG + Intronic
1045067323 8:98460415-98460437 CCAAAGTCTAATCTGAGACAAGG - Intronic
1045849374 8:106674477-106674499 CCAAAGTCTTACCCGAGACAAGG - Intronic
1047937644 8:129798049-129798071 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1047968058 8:130061654-130061676 ACAGAGGTTAACCCGAGACAGGG - Intronic
1049903055 9:188922-188944 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1051860725 9:21622567-21622589 CCAAAGGCTCATCTGAGACAAGG + Intergenic
1052294649 9:26883061-26883083 CCAAAGGCTCATCTGAGACAAGG - Intronic
1052505330 9:29346136-29346158 GCAAAAGCTAAACATGGACATGG - Intergenic
1052877958 9:33581491-33581513 TCAAAGTCTCATCCGAGACAAGG - Intergenic
1053498023 9:38562714-38562736 TCAAAGTCTCATCCGAGACAAGG + Intronic
1053566891 9:39262300-39262322 GGAAATGCAAAACCTAGACAAGG - Intronic
1053832668 9:42100145-42100167 GGAAATGCAAAACCTAGACAAGG - Intronic
1054130252 9:61356707-61356729 GGAAATGCAAAACCTAGACAAGG + Intergenic
1054597885 9:67087267-67087289 GGAAATGCAAAACCTAGACAAGG + Intergenic
1054682270 9:68232075-68232097 CCAAAGTCTCATCCGAGACAAGG - Intronic
1056586383 9:87930154-87930176 TCAAAGTCTCATCCGAGACAAGG + Intergenic
1056610496 9:88122789-88122811 TCAAAGTCTCATCCGAGACAAGG - Intergenic
1056865396 9:90224065-90224087 GCAAAGGCTAAACCGAGATAGGG + Intergenic
1056917613 9:90758823-90758845 GCAAAGGCTAAACCGAGACAGGG - Intergenic
1057161206 9:92889602-92889624 TCAAAGTCTCATCCGAGACAAGG + Intergenic
1057300144 9:93873459-93873481 GCAAAGGCTCATCTGAGATAAGG - Intergenic
1057677494 9:97147213-97147235 TCAAAGTCTCATCCGAGACAAGG + Intergenic
1058223107 9:102326511-102326533 CCAAAGTCTTATCCGAGACAAGG - Intergenic
1058309827 9:103486101-103486123 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1059187193 9:112284920-112284942 CCAAAGTCTAATCTGAGACAAGG - Intronic
1059487483 9:114637839-114637861 GAAAAGGCTAATCCTAGAGAAGG - Intronic
1059587155 9:115619101-115619123 TCAAAGGCTCATCTGAGACAAGG + Intergenic
1059813240 9:117881145-117881167 TCAAAGCCTAATCCAAGACAAGG + Intergenic
1059843224 9:118242405-118242427 GCAAAGTCTAATCTGAAACAAGG + Intergenic
1062224601 9:135442587-135442609 GCAAAGGCTAAAGGGAGACAGGG - Intergenic
1202782205 9_KI270718v1_random:9978-10000 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1186402092 X:9269484-9269506 GGAAAGGCTAAACCCAGGCACGG + Intergenic
1187360643 X:18624443-18624465 GCAAAAGCTCAAGCCAGACAAGG - Intronic
1187667299 X:21627946-21627968 CCAAAGTCTCATCCGAGACAAGG + Intronic
1188162435 X:26820077-26820099 GCAAAGTCTCATCTGAGACAAGG - Intergenic
1188615147 X:32149185-32149207 GCCAAGGCTAAAGGGATACACGG + Intronic
1189028733 X:37428292-37428314 CCAAAGTCTAATCTGAGACAAGG + Intronic
1189435637 X:40990511-40990533 GCAAAGTCTTATCTGAGACAAGG + Intergenic
1189945216 X:46170931-46170953 CCAAAGTCTCATCCGAGACAAGG + Intergenic
1190315326 X:49146981-49147003 GCAAAGGCTAAACTGGTAGAGGG - Intergenic
1192284520 X:69721004-69721026 TCACAGGCTAAACCTAAACAAGG - Intronic
1193482528 X:82044792-82044814 CCAAAGTCTAATCTGAGACAAGG - Intergenic
1193808105 X:86017196-86017218 GCAAAGTCTCATCTGAGACAAGG - Intronic
1193917452 X:87382748-87382770 CCAAAGTCTTAACTGAGACAAGG - Intergenic
1194400118 X:93431690-93431712 GCAAAGGCTAAACCGATACAGGG + Intergenic
1197341127 X:125267126-125267148 TCAAAGTCTCAACTGAGACAAGG - Intergenic
1199063710 X:143389337-143389359 CCAAAGTCTCAACTGAGACAAGG - Intergenic
1199309953 X:146310872-146310894 GCAAAGTCTCATCTGAGACAAGG + Intergenic
1200255826 X:154582274-154582296 CCAAAGTCTCAACTGAGACAAGG - Intergenic
1200261943 X:154622129-154622151 CCAAAGTCTCAACTGAGACAAGG + Intergenic
1200947932 Y:8864762-8864784 GCAAAGGCTAAACTGATACAGGG + Intergenic
1202036889 Y:20645205-20645227 GCAAAGCCTAAACAGGTACAGGG + Intergenic