ID: 969733787

View in Genome Browser
Species Human (GRCh38)
Location 4:8973456-8973478
Sequence CCGAGACAGGGAAGCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733781_969733787 10 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733776_969733787 26 Left 969733776 4:8973407-8973429 CCCACACCCAGTTGGACCCACAT No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733777_969733787 25 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733779_969733787 19 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733778_969733787 20 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data
969733782_969733787 9 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733787 Original CRISPR CCGAGACAGGGAAGCTCTCT TGG Intergenic
No off target data available for this crispr