ID: 969733788

View in Genome Browser
Species Human (GRCh38)
Location 4:8973460-8973482
Sequence GACAGGGAAGCTCTCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 41, 1: 19, 2: 7, 3: 25, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969733781_969733788 14 Left 969733781 4:8973423-8973445 CCCACATGAAAGAGAGGATATGC 0: 32
1: 30
2: 6
3: 28
4: 305
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733777_969733788 29 Left 969733777 4:8973408-8973430 CCACACCCAGTTGGACCCACATG No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733782_969733788 13 Left 969733782 4:8973424-8973446 CCACATGAAAGAGAGGATATGCA No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733778_969733788 24 Left 969733778 4:8973413-8973435 CCCAGTTGGACCCACATGAAAGA No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733779_969733788 23 Left 969733779 4:8973414-8973436 CCAGTTGGACCCACATGAAAGAG No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193
969733776_969733788 30 Left 969733776 4:8973407-8973429 CCCACACCCAGTTGGACCCACAT No data
Right 969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG 0: 41
1: 19
2: 7
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969733788 Original CRISPR GACAGGGAAGCTCTCTTGGA AGG Intergenic
900091355 1:922109-922131 AACAGGGGAGGGCTCTTGGAAGG + Intergenic
902986223 1:20155856-20155878 TACAGGGAAGCCCTTCTGGAAGG + Intergenic
905646463 1:39627966-39627988 GCCAGGGACCCTCTCTTTGATGG + Intronic
906391271 1:45418957-45418979 GTCAGGGAAGCCTTCTAGGAGGG - Intronic
907464365 1:54624991-54625013 GACAGGGAGGTTCTGTTGGCTGG + Intronic
908850938 1:68375123-68375145 CATAGGGAAGATCTCTTGGAAGG + Intergenic
909235187 1:73143896-73143918 GACAGGGAGGATCTCTTGTATGG + Intergenic
910642162 1:89474822-89474844 GTCAGGGATGTTCTCTTGGATGG - Intergenic
911973775 1:104466503-104466525 TATAGGGAAGCACTCTTAGAAGG - Intergenic
913341445 1:117761382-117761404 GACAGGGCAACTCTCTTGTTAGG + Intergenic
913533664 1:119750995-119751017 CACAGTGAAGCTCTCTTGGCTGG + Intronic
914859130 1:151372167-151372189 CACAGCAAAGCTCTCTGGGAGGG - Intronic
915656734 1:157366916-157366938 GGCAAGGAAGAACTCTTGGAAGG + Intergenic
918184707 1:182116467-182116489 GACAGGCAGGCTCTCTGGGCTGG - Intergenic
918372736 1:183877525-183877547 GGCAGGGAAGCTTTCTGGAAAGG - Intronic
919084998 1:192911008-192911030 GACAGGGATTCTCTCCTGGTAGG - Intergenic
921747361 1:218753391-218753413 TATAGGGAAGCACTCTTAGAAGG - Intergenic
922213152 1:223500639-223500661 AAAATGAAAGCTCTCTTGGAGGG + Intergenic
1064394909 10:14974111-14974133 GACAGGGAAGCTCTCTTGGAAGG - Intronic
1064395965 10:14982241-14982263 GGCAGGGAAGCTCTCTTGGAAGG - Intronic
1064397664 10:14994427-14994449 CACAAGGAAGCTCTCTTGGAAGG - Intergenic
1065893290 10:30139050-30139072 GCCAGGGAAGCTCAGATGGAAGG - Intergenic
1066389995 10:34970756-34970778 TACAGGGAAGCTCTCTTGGAAGG + Intergenic
1067087772 10:43251968-43251990 GACAGGGAGGCCCTGCTGGATGG + Intronic
1069825285 10:71251211-71251233 GACAGGGAAACTCCTTTGGAAGG - Intronic
1071274911 10:84044705-84044727 TACAGGGAAGCTGCCTTGAAAGG - Intergenic
1072052948 10:91724630-91724652 GCCAGGGAAATTCTCTTTGAGGG - Intergenic
1072806415 10:98426267-98426289 GGCAGGGAAACACTCGTGGATGG + Intronic
1075711240 10:124531538-124531560 GACAGGGAAGTGCTCCAGGACGG - Intronic
1075849172 10:125573648-125573670 GAGAGGGAGGCCCTCTTGGGTGG - Intergenic
1076226622 10:128781780-128781802 GACAAGGAAGGGCTCCTGGAAGG - Intergenic
1076872814 10:133201942-133201964 GACCAGGAAGCTCTGCTGGAAGG - Intronic
1077008594 11:370216-370238 GTCAGGGACCCTCTCTGGGAGGG - Intronic
1077589415 11:3480163-3480185 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1081092543 11:38890509-38890531 GAAAGGAAAGTTCACTTGGAAGG - Intergenic
1081178858 11:39963213-39963235 GACAGGGCTGCTCTCTTCAAAGG - Intergenic
1083177678 11:60961687-60961709 GACACGTAAGCTCTCTTCAAGGG - Intergenic
1084169931 11:67396193-67396215 GACAGGGAAGGGCTCTGGGATGG + Intronic
1084228145 11:67730404-67730426 GACAGGGAAGCTCTCCTGGAAGG - Intergenic
1084229849 11:67743649-67743671 GAGAGAGAAGCTCTCCTGGCAGG - Intergenic
1084245135 11:67851938-67851960 GACTGGGAAGCTCTCTTGGAAGG - Intergenic
1084261538 11:67982085-67982107 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1084807080 11:71586458-71586480 GACAGGGAAGCTCTCTTGGAAGG + Intronic
1084811104 11:71612026-71612048 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
1084827553 11:71742640-71742662 GACAGGGAATCTCTCTTGGAAGG + Intergenic
1084844164 11:71886470-71886492 GACAGGGAAGCTCTCTTGGAAGG + Intronic
1084847019 11:71908928-71908950 GACAGAGAAGCTCTCCTGGAAGG + Intronic
1084937407 11:72594533-72594555 GGCAGGGAAGAACTCTTGAAAGG - Intronic
1085101732 11:73806435-73806457 GTCAGGGAAGGCCTCTTGGATGG - Intronic
1085465094 11:76717654-76717676 GGCAGGGAAGCCCACTTGGGGGG - Intergenic
1086700342 11:89894690-89894712 TGCAGGGAGCCTCTCTTGGAGGG - Intergenic
1086705828 11:89949836-89949858 TGCAGGGAGCCTCTCTTGGAGGG + Intergenic
1086996988 11:93369203-93369225 GAGAGTGAAGCTCTCATGAATGG - Intronic
1089460781 11:118652204-118652226 GTCAGGGAAGGTTTCTTAGAGGG - Intronic
1089775290 11:120831570-120831592 GAGACGGAAGCTCCCTTGGGTGG - Intronic
1090843734 11:130514195-130514217 AACTGGGAACCTCTCTTGTAAGG + Intergenic
1091155158 11:133365478-133365500 GACAGTGGGGCTCTCATGGATGG - Intronic
1091562696 12:1627169-1627191 GTCAGGGAAGGCATCTTGGAAGG + Intronic
1092415708 12:8289069-8289091 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1092432835 12:8422654-8422676 GACAGGGAAGCTCTCTTGGGAGG - Intergenic
1092435424 12:8443283-8443305 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1094778164 12:33756931-33756953 GACAGAGAAGCTAGCTTGAATGG - Intergenic
1096447897 12:51710760-51710782 GTCAGGGAAGGTTTCTTGAAAGG - Intronic
1098218057 12:68240605-68240627 ATCAGGGAAGGCCTCTTGGAGGG - Intergenic
1102865497 12:116370883-116370905 GTCAGGGCAGCTTTCTTGCATGG - Intergenic
1104292470 12:127482814-127482836 TACAGGGAATCCCTCCTGGAAGG + Intergenic
1104489855 12:129184317-129184339 CACAGGCAGGCCCTCTTGGAAGG - Intronic
1104539761 12:129653061-129653083 GTCAAGGAAGCTCTGTTGGATGG + Intronic
1104769853 12:131354630-131354652 GCCAGGAAAGATCTCTTAGAGGG + Intergenic
1104791105 12:131482671-131482693 GTCAGGAAAGCTCTCTGAGAAGG - Intergenic
1105945709 13:25187790-25187812 GACAGGAAAGTTCTCCTGGAAGG + Intergenic
1106554520 13:30798306-30798328 GCAAGGGAAGCTGTGTTGGAGGG - Intergenic
1107043149 13:35969849-35969871 GACAGTGAAGCCCTCATGAATGG + Intronic
1107544597 13:41424182-41424204 GACACAGAAGCTCTCTTGGAAGG - Intergenic
1110894057 13:80726927-80726949 GACAGTGATGCTATTTTGGAAGG + Intergenic
1114562221 14:23601574-23601596 GGCAAGGCAGCTCTCTGGGATGG - Intergenic
1116438040 14:44915874-44915896 GACAGTGGAGCCCTCCTGGATGG + Intergenic
1117038365 14:51749032-51749054 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
1118728239 14:68646888-68646910 GACAGAGAAGCTCACTTTTAAGG - Intronic
1119003668 14:70905770-70905792 GACAGGAAAGCTCTCTGGGAAGG - Intergenic
1119228112 14:72959721-72959743 CCCAGGGAAGCTCTCCAGGAAGG - Intergenic
1119620380 14:76127255-76127277 GACAGGAAGGCTCTCCTGGGTGG + Intergenic
1120019016 14:79507165-79507187 AACACGGAAGCTAACTTGGAAGG + Intronic
1122088643 14:99323627-99323649 GACAGGGAAGCCTCCTGGGAAGG + Intergenic
1124556678 15:30732297-30732319 GACATGGAGGTTCTCTTGTAAGG + Intronic
1128888872 15:71312868-71312890 GACAGTGAAGGTCTCTTGCAGGG - Intronic
1130221095 15:82020344-82020366 CTCAGGGAAGCCATCTTGGAAGG - Intergenic
1132798498 16:1739400-1739422 CACAGGGATGCTCACATGGACGG - Intronic
1133111497 16:3550568-3550590 GTCAGGGAAGCCCTCCTGGGAGG + Intronic
1133236408 16:4389284-4389306 GAGAGGGAAGCTCACATGGTGGG + Intronic
1133475573 16:6118487-6118509 GTCAAGGTAGCTGTCTTGGATGG + Intronic
1135912063 16:26570530-26570552 GAAAGGGAAGCTCTGGTGGGTGG - Intergenic
1136033337 16:27519383-27519405 GACATGGAAGCTGGCTTGGAGGG + Intronic
1136133518 16:28240002-28240024 GAATGGGAAGCTCACTTGCATGG - Intergenic
1137374358 16:47940070-47940092 GATAGGGAGGCTATCTGGGATGG - Intergenic
1137976146 16:53033787-53033809 GACAGGCAACCTCTCTGGGCTGG + Intergenic
1138451743 16:57097409-57097431 GTGAGGGAAGCTCTCCTGGAAGG + Intronic
1138593330 16:58015403-58015425 GACAGGGAGGCTCGCTTTGAAGG - Intronic
1141853384 16:86664111-86664133 GACAGGGAAGTCTTCTTAGAGGG - Intergenic
1141895958 16:86958949-86958971 GCCATGGTAGCTCTCTTGGAAGG - Intergenic
1145826350 17:27879923-27879945 GAGAGGGAAGCTGTCCTGGCGGG - Intronic
1145865272 17:28237271-28237293 TACAGGGAAGCTCTCTTGGAAGG - Intergenic
1146798783 17:35801896-35801918 GGCAGGGCCGCTCTCTAGGAAGG + Intronic
1147213777 17:38887365-38887387 GAAAGGGAAGATCTCTAGCAGGG - Intronic
1150617829 17:66785698-66785720 GACAGAGCAACTCTCTTGGGAGG - Intronic
1155254756 18:23985079-23985101 GAGAGTGAAGCTCTCATGAATGG - Intergenic
1156460522 18:37319089-37319111 CACACGGAAGCTGTCATGGATGG - Intronic
1156462307 18:37327861-37327883 GACAGGGAAGCTTTCCAGGTGGG - Intronic
1157557282 18:48621265-48621287 GTCAGGGAAGCTGGCATGGAGGG + Intronic
1159706557 18:71696535-71696557 GACAGGGCAGCTCTCTCTAAAGG - Intergenic
1160176808 18:76601611-76601633 GACGGGGAAGCTCTTCTGCAGGG - Intergenic
1163966780 19:20753569-20753591 TACAGGAAAGCTCTCTTAGAAGG - Intronic
1164480612 19:28608504-28608526 TACAGGGAAGCCCTTCTGGAAGG + Intergenic
925232128 2:2242889-2242911 GACAGACCAGCTCTCTAGGAAGG + Intronic
931699453 2:64898081-64898103 TACAGGGAAGCCCTTCTGGAAGG - Intergenic
931923364 2:67044704-67044726 GACTGGGAAGGACCCTTGGAAGG + Intergenic
932349492 2:71020840-71020862 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
932353070 2:71047328-71047350 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
932423943 2:71617454-71617476 GACAGGGAGGCTTTCCTGGCAGG + Intronic
933935881 2:87203586-87203608 TACAGGGAAGCCCTTCTGGAAGG - Intergenic
934571506 2:95375726-95375748 CACAGGGAAGCTGTCTGGGTGGG - Intronic
934580965 2:95437619-95437641 TGCAGGGAACCTGTCTTGGAGGG + Intergenic
934598485 2:95639095-95639117 TGCAGGGAACCTGTCTTGGAGGG - Intergenic
935089658 2:99882582-99882604 GAAGGGGCATCTCTCTTGGAAGG + Intronic
936079286 2:109421424-109421446 GACAGAGAAGCCTTCTTGGGTGG - Intronic
936357266 2:111762244-111762266 TACAGGGAAGCCCTTCTGGAAGG + Intergenic
937499484 2:122462563-122462585 GAAAGGAAAGTTCACTTGGAAGG - Intergenic
937830286 2:126412897-126412919 GACAGGGTACCTCTTTTGTAAGG - Intergenic
939662740 2:144910649-144910671 GACAGGGAAGCTATCTTTCTGGG - Intergenic
940871771 2:158866622-158866644 GACAGGGAAGCTGTCTTGGAAGG + Intergenic
940873991 2:158882626-158882648 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
942147901 2:173044212-173044234 GACCGGGAAGCTACCTTAGATGG - Intronic
944210107 2:197198212-197198234 GACAGGGATCCTATCATGGAAGG + Intronic
946881262 2:224179522-224179544 GACGGTGAAGCCCTCTTGAATGG - Intergenic
947594561 2:231402750-231402772 GACAGGGAAGCTGTCTTGGAAGG + Intergenic
948418478 2:237836122-237836144 GACAGGCACGCTCTCTTGTTAGG + Intronic
1168842039 20:915811-915833 CTCAGGGAAGGCCTCTTGGATGG + Intronic
1168844698 20:935920-935942 CCCAGGGAAGATCTCTTGAAGGG - Intergenic
1169161084 20:3379021-3379043 CTCAGGGAAGGGCTCTTGGAGGG - Intronic
1169206944 20:3745872-3745894 GAGAGGAAAGCTGGCTTGGAGGG - Intronic
1169909307 20:10634437-10634459 TAAAGAGAAGCTCTCTTGGCAGG - Intronic
1170553067 20:17493826-17493848 GACAGGGATGCTCTGTTAAATGG - Intergenic
1171407472 20:24921274-24921296 TACAGGGAAGCTCTCTTGGAAGG + Intergenic
1171466984 20:25336738-25336760 GACAGAGAACCACACTTGGAAGG + Intronic
1172886579 20:38235294-38235316 GACAGGGAAGCCCTCTCCTAAGG + Intronic
1173604784 20:44324279-44324301 GTCAGGGAAGAGTTCTTGGAAGG + Intergenic
1174590222 20:51639379-51639401 GAAAGGGAAGATCTGTAGGATGG + Exonic
1174819309 20:53713384-53713406 GACAGGCAGGCTCCCTGGGAGGG - Intergenic
1175250249 20:57604824-57604846 CACAGGGACCCGCTCTTGGAAGG + Intronic
1177753888 21:25321375-25321397 GTCAGAGAAGTTATCTTGGATGG + Intergenic
1177857001 21:26410987-26411009 GAAAGCCAATCTCTCTTGGAAGG - Intergenic
1177867599 21:26531232-26531254 CACAGGGAAGCTGGATTGGATGG + Intronic
1183087406 22:35494987-35495009 AAAAGGGAAGCTCTGATGGAGGG - Intergenic
1184866337 22:47203697-47203719 GACAGGGATGCACCCGTGGACGG - Intergenic
949365527 3:3276544-3276566 GGCTGGGCAGCTCTCTTGGAGGG + Intergenic
950898041 3:16471363-16471385 GACAGAGAAGCTTTCTTCCAAGG + Intronic
951096741 3:18641004-18641026 GACAGGCTAGCTCTCTTGTTAGG - Intergenic
951432707 3:22627061-22627083 GTTGGGGAAGTTCTCTTGGATGG + Intergenic
954791462 3:53136309-53136331 ATCAGGGAAGCTTTCCTGGAGGG + Intergenic
955143505 3:56292862-56292884 GTCAGGGAAGGCCTCTTGGAGGG - Intronic
956705662 3:71996733-71996755 GAAAGGGCACCTCTCATGGAGGG - Intergenic
957022075 3:75138213-75138235 TACAGGGAAGCCCTTCTGGAAGG + Intergenic
957044824 3:75365469-75365491 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
957076614 3:75607658-75607680 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
957308029 3:78483354-78483376 AAAAGGGAAAGTCTCTTGGATGG + Intergenic
957314583 3:78560893-78560915 GACAGGGGATCCCTCTTGAATGG - Intergenic
961017894 3:123481699-123481721 GACAGGGAAGGGCTGGTGGAAGG - Intergenic
961271839 3:125695298-125695320 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
961274679 3:125717524-125717546 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
961277600 3:125740156-125740178 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
961876824 3:130029507-130029529 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
961878483 3:130042734-130042756 GAGAGAGAAGCTCTCCTGGCAGG - Intergenic
961893254 3:130147682-130147704 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
965011007 3:163090985-163091007 GACAGTGAAGCTCTCATGACTGG + Intergenic
966015475 3:175132760-175132782 GACAGGGCGGCTCTCCTGGCGGG + Intronic
967253841 3:187569916-187569938 GACTGTGAAGCACTCCTGGAAGG + Intergenic
968541388 4:1170067-1170089 GACAAGGAAGCTTGCTAGGATGG - Intronic
968913877 4:3488801-3488823 GCCAGGGAAACTCTTTGGGATGG + Intronic
968989097 4:3896709-3896731 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
968990701 4:3909609-3909631 GAGAGAGAAGCTCTCCTGGCAGG - Intergenic
969020065 4:4133952-4133974 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
969024774 4:4164354-4164376 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
969729044 4:8942809-8942831 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
969733788 4:8973460-8973482 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
969749508 4:9099460-9099482 TACAGGGAAGCTCTCTTGGAAGG + Intergenic
969785218 4:9452344-9452366 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
969788633 4:9476751-9476773 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
969793378 4:9507520-9507542 GACAGGGAAGCGCTCTTGGAAGG + Intergenic
969826260 4:9760886-9760908 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
970288863 4:14549969-14549991 GACAGGGAAGCCCTCTCTGAAGG - Intergenic
970447752 4:16138352-16138374 GTCACAAAAGCTCTCTTGGAAGG + Intergenic
970529206 4:16965129-16965151 GACAGGGAAGCTCACTTACTGGG - Intergenic
971073656 4:23124285-23124307 GACAGGAGAGACCTCTTGGATGG + Intergenic
972375091 4:38462400-38462422 GGCAGGGAAGATGTCCTGGAAGG + Intergenic
973233812 4:47873741-47873763 GACAGGCAAACTCTCTTGTTAGG - Intronic
978400716 4:108327639-108327661 CCCAGGGATGCTCTCTTGGCTGG + Intergenic
986295475 5:6434043-6434065 GACCGGGAAGCTCTATGGGATGG + Intergenic
987868445 5:23577746-23577768 GAGAGGGAAGCTTTCATGAAAGG - Intergenic
988840948 5:35083340-35083362 GAACGGGAAGCTCTCTGGCATGG - Intronic
989207707 5:38827889-38827911 GAGAGGGGAACTCTCCTGGATGG + Intergenic
991443198 5:66672909-66672931 GACAGGGAACCCCTCATGTAAGG - Intronic
993400404 5:87442784-87442806 GACAGGCAAACTCTCTTGTTAGG - Intergenic
993906396 5:93628436-93628458 GACAGGGTAACTCTCTTGTTAGG - Intronic
995856739 5:116600673-116600695 ATCAGGGAAGGTCTCTTTGAGGG + Intergenic
998415930 5:141945967-141945989 GACAGGGAAGCTCCCTGGGTAGG + Intronic
1002303152 5:178268896-178268918 GCCAGGGCAGCTCTCATTGAGGG - Intronic
1005361282 6:25033345-25033367 GACTGGGGAGCTGCCTTGGAGGG - Intronic
1007785962 6:44279480-44279502 CCCAGGGAAGCTCTCTGGGGTGG + Exonic
1008644929 6:53504499-53504521 TACATGGAATCTCTCTTAGATGG + Intronic
1010085149 6:71908510-71908532 GACAGGAAGGCTCTCTAAGAAGG - Intronic
1011564918 6:88664169-88664191 TATAGGGAAGCACTCTTAGAAGG + Intronic
1011991489 6:93524449-93524471 TACAGGGATGATCTCTTGGGTGG + Intergenic
1012612110 6:101229863-101229885 TACAGGGAAGCCCTTCTGGAAGG - Intergenic
1012666932 6:101982955-101982977 AACAGGGAAGTTCCCTTAGAGGG + Intronic
1012732830 6:102903503-102903525 GTAAGGGAGGCTATCTTGGATGG + Intergenic
1014853263 6:126367732-126367754 GACAGTGAAACTCATTTGGAAGG + Intergenic
1017956244 6:159180137-159180159 GCCAGTCATGCTCTCTTGGAAGG + Intronic
1018444687 6:163844544-163844566 GATAGGGAAGCCCTCTTGGCTGG + Intergenic
1019644711 7:2122898-2122920 GACGGGGAAGCTCACCTGGGAGG - Intronic
1020307474 7:6845987-6846009 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1020311948 7:6874813-6874835 GACAGGGAAGCTTTCTTGGAAGG - Intergenic
1020313534 7:6887726-6887748 GAGAGAGAAGCTCTCCTGGCAGG - Intergenic
1020323479 7:6957179-6957201 TACAGGGAAGCTCTCTTGGAAGG - Intergenic
1020497048 7:8868043-8868065 GAAAGGGAAGATATCATGGAGGG + Intergenic
1021467532 7:20962447-20962469 GACAGGGATGCTTCCATGGAAGG - Intergenic
1021950865 7:25773532-25773554 GACAGTGAAGCCCTCGTGAATGG + Intergenic
1029078597 7:97954926-97954948 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1030254221 7:107489705-107489727 GACTGGGAGGCTTTCTTTGAGGG - Intronic
1031467548 7:122131885-122131907 GACAGAGAAGCCCCCTTGGAAGG + Intronic
1033149604 7:138901927-138901949 GACATGCAAGCTCTCTTAGTAGG - Intronic
1034467052 7:151235958-151235980 AACAGGGCAGCTCTCTGGGCTGG - Intronic
1036239413 8:7069553-7069575 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
1036262477 8:7251572-7251594 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036304111 8:7587986-7588008 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
1036314516 8:7710111-7710133 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036354965 8:8035978-8036000 GACAGGGAAGCTCTCTTGGAAGG + Intergenic
1036372579 8:8173803-8173825 TACAGGGAAGCTCTCTTGGAAGG + Intergenic
1036388250 8:8301038-8301060 GACAGGCTAGCTCTCTTGTTAGG - Intergenic
1036629013 8:10497246-10497268 GCCAGGGAAGATCTCTGGGAGGG - Intergenic
1036817039 8:11910061-11910083 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036817375 8:11912372-11912394 CAGAGAGAAACTCTCTTGGAAGG - Intergenic
1036820336 8:11934952-11934974 GACAGAGAAGCTCTCTTGGAAGG - Intergenic
1036833771 8:12041567-12041589 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036855615 8:12288132-12288154 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036878325 8:12491838-12491860 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036903933 8:12691975-12691997 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1036906406 8:12711645-12711667 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1038115768 8:24553623-24553645 GAGAAAGAAGCTCTCATGGATGG + Intergenic
1038294374 8:26277515-26277537 GAGAGTGGAGCTCTCTTGTATGG - Intergenic
1038348046 8:26750174-26750196 GACAAGGAAGCTGTCTGGGCTGG + Intronic
1038798695 8:30730608-30730630 TACAGGGAAGCTCTCTTAGAAGG + Intergenic
1039277947 8:35953505-35953527 TACAGGGAAGCCCTCCTGGAAGG + Intergenic
1039715442 8:40103302-40103324 GACAGGGATGGTTCCTTGGAAGG + Intergenic
1041571054 8:59337208-59337230 GAAGGAGCAGCTCTCTTGGATGG + Intergenic
1045133145 8:99180568-99180590 GTCAGGGAAGTTCTCTTACATGG + Intronic
1047251179 8:123182968-123182990 GCCACGGACGCCCTCTTGGATGG + Exonic
1048348939 8:133600214-133600236 GCCTGGCAAGCTCTGTTGGAGGG + Intergenic
1052028216 9:23598554-23598576 GACAGGGAAGCCCTTTTACATGG + Intergenic
1054356817 9:64070490-64070512 GAAAGTGGAGCTCCCTTGGATGG - Intergenic
1056087576 9:83166932-83166954 GAAAGGGAATCTCTCTTTAAGGG + Intergenic
1056865399 9:90224081-90224103 GATAGGGAAGCTCTCTTGGAAGG + Intergenic
1056917610 9:90758807-90758829 GACAGGGAAGCTCTCTTGGAAGG - Intergenic
1056991764 9:91419926-91419948 CACAGATAAGCTCTCTTGTAGGG - Intronic
1057817659 9:98307437-98307459 GAGAGAGAAGGCCTCTTGGAGGG - Intronic
1058785249 9:108380747-108380769 GACAAGGAAGATCTCTCTGAAGG - Intergenic
1059042093 9:110826174-110826196 GACAAGGAAGCCTTCCTGGAGGG - Intergenic
1059881772 9:118698318-118698340 GACAGCAAAGCCCTCATGGATGG - Intergenic
1059899517 9:118907614-118907636 GACAGACAAGGTCTCTTGAAAGG + Intergenic
1061053158 9:128207820-128207842 GACAGGCAAGCCCTCTGGGATGG + Intronic
1061067111 9:128285402-128285424 GACTGGAAAGCTATCTGGGATGG + Intronic
1062224599 9:135442571-135442593 GACAGGGAAGCTGTCTTGGAAGG - Intergenic
1186344006 X:8672461-8672483 GACAAGGAAACTCTCTTGTGTGG - Intronic
1187488210 X:19724803-19724825 GTCAGGGAAGGTGTCTGGGAGGG - Intronic
1189220519 X:39367900-39367922 GGCAGGGAAGCCCTCCTTGAAGG + Intergenic
1189368782 X:40411370-40411392 GACAGGAAAGCTGTCTGGGTAGG + Intergenic
1190315324 X:49146965-49146987 TAGAGGGAAGCCCTCCTGGAAGG - Intergenic
1190655111 X:52604951-52604973 GGCAGGGAAGCGCTCATCGATGG - Intergenic
1190971957 X:55358062-55358084 GTTGGGGAAGTTCTCTTGGATGG - Intergenic
1193810591 X:86046557-86046579 GCCAGAGAAGCTCTGGTGGATGG - Intronic
1194400121 X:93431706-93431728 TACAGGGAAGCTCTCTTGGAAGG + Intergenic
1197470468 X:126861853-126861875 GAAAGGAAAGTTCACTTGGAAGG - Intergenic
1198763810 X:140061275-140061297 GACAGGAAAGCACTCTGGTAAGG - Intergenic
1198799039 X:140431145-140431167 GAGATGGAAGTGCTCTTGGAAGG - Intergenic
1200947934 Y:8864778-8864800 TACAGGGAAGTTCTCTTGGAAGG + Intergenic
1202036892 Y:20645221-20645243 TACAGGGAAGCCCTCTTGGAAGG + Intergenic