ID: 969737465

View in Genome Browser
Species Human (GRCh38)
Location 4:9001066-9001088
Sequence ACGCGGGCGCAGGGGTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969737455_969737465 9 Left 969737455 4:9001034-9001056 CCAGACAGGTGGCGACGGCAGAG No data
Right 969737465 4:9001066-9001088 ACGCGGGCGCAGGGGTCCGGGGG No data
969737452_969737465 16 Left 969737452 4:9001027-9001049 CCGGCACCCAGACAGGTGGCGAC No data
Right 969737465 4:9001066-9001088 ACGCGGGCGCAGGGGTCCGGGGG No data
969737454_969737465 10 Left 969737454 4:9001033-9001055 CCCAGACAGGTGGCGACGGCAGA No data
Right 969737465 4:9001066-9001088 ACGCGGGCGCAGGGGTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969737465 Original CRISPR ACGCGGGCGCAGGGGTCCGG GGG Intergenic