ID: 969738030

View in Genome Browser
Species Human (GRCh38)
Location 4:9004103-9004125
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969738030_969738033 -10 Left 969738030 4:9004103-9004125 CCAGGGTGTGTCTGACCCACAGC No data
Right 969738033 4:9004116-9004138 GACCCACAGCTCCTCCTGGAGGG No data
969738030_969738038 10 Left 969738030 4:9004103-9004125 CCAGGGTGTGTCTGACCCACAGC No data
Right 969738038 4:9004136-9004158 GGGAGAGAAAAGTCTCTCCTAGG No data
969738030_969738039 17 Left 969738030 4:9004103-9004125 CCAGGGTGTGTCTGACCCACAGC No data
Right 969738039 4:9004143-9004165 AAAAGTCTCTCCTAGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969738030 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr