ID: 969739183

View in Genome Browser
Species Human (GRCh38)
Location 4:9011936-9011958
Sequence TCTGCACCCTGGTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969739177_969739183 0 Left 969739177 4:9011913-9011935 CCTCTTTCTTTTACTCACACCAG No data
Right 969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG No data
969739176_969739183 3 Left 969739176 4:9011910-9011932 CCGCCTCTTTCTTTTACTCACAC No data
Right 969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969739183 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG Intergenic
No off target data available for this crispr