ID: 969739862

View in Genome Browser
Species Human (GRCh38)
Location 4:9016340-9016362
Sequence GTCTTCTCAATTACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969739862_969739864 1 Left 969739862 4:9016340-9016362 CCTGCTCTAGTAATTGAGAAGAC No data
Right 969739864 4:9016364-9016386 GTCTCTAGAATATGATTCCCTGG No data
969739862_969739865 2 Left 969739862 4:9016340-9016362 CCTGCTCTAGTAATTGAGAAGAC No data
Right 969739865 4:9016365-9016387 TCTCTAGAATATGATTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969739862 Original CRISPR GTCTTCTCAATTACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr