ID: 969739864

View in Genome Browser
Species Human (GRCh38)
Location 4:9016364-9016386
Sequence GTCTCTAGAATATGATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969739862_969739864 1 Left 969739862 4:9016340-9016362 CCTGCTCTAGTAATTGAGAAGAC No data
Right 969739864 4:9016364-9016386 GTCTCTAGAATATGATTCCCTGG No data
969739861_969739864 23 Left 969739861 4:9016318-9016340 CCTGCTAGATTCTGGGGAGGTAC No data
Right 969739864 4:9016364-9016386 GTCTCTAGAATATGATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969739864 Original CRISPR GTCTCTAGAATATGATTCCC TGG Intergenic
No off target data available for this crispr