ID: 969741960

View in Genome Browser
Species Human (GRCh38)
Location 4:9035020-9035042
Sequence ATGGCCTCGTGGGATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969741960_969741968 0 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741968 4:9035043-9035065 ATTTCAGACTATCACATGGGGGG 0: 4
1: 1
2: 2
3: 11
4: 130
969741960_969741967 -1 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741967 4:9035042-9035064 TATTTCAGACTATCACATGGGGG 0: 5
1: 4
2: 2
3: 16
4: 193
969741960_969741970 30 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741970 4:9035073-9035095 GAATAATACCCAGCTTTCAAGGG No data
969741960_969741969 29 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741969 4:9035072-9035094 TGAATAATACCCAGCTTTCAAGG No data
969741960_969741966 -2 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741966 4:9035041-9035063 ATATTTCAGACTATCACATGGGG 0: 521
1: 195
2: 135
3: 68
4: 311
969741960_969741964 -4 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741964 4:9035039-9035061 CCATATTTCAGACTATCACATGG 0: 522
1: 203
2: 143
3: 69
4: 203
969741960_969741965 -3 Left 969741960 4:9035020-9035042 CCTTTCTCATCCCACGAGGCCAT No data
Right 969741965 4:9035040-9035062 CATATTTCAGACTATCACATGGG 0: 522
1: 194
2: 147
3: 66
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969741960 Original CRISPR ATGGCCTCGTGGGATGAGAA AGG (reversed) Intergenic
No off target data available for this crispr