ID: 969744495

View in Genome Browser
Species Human (GRCh38)
Location 4:9059469-9059491
Sequence GGGTCGTGATCATGAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969744495_969744504 18 Left 969744495 4:9059469-9059491 CCACTCTCTCATGATCACGACCC No data
Right 969744504 4:9059510-9059532 AGAGTTGTGAGCCCTTAAAAGGG No data
969744495_969744503 17 Left 969744495 4:9059469-9059491 CCACTCTCTCATGATCACGACCC No data
Right 969744503 4:9059509-9059531 TAGAGTTGTGAGCCCTTAAAAGG No data
969744495_969744505 23 Left 969744495 4:9059469-9059491 CCACTCTCTCATGATCACGACCC No data
Right 969744505 4:9059515-9059537 TGTGAGCCCTTAAAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969744495 Original CRISPR GGGTCGTGATCATGAGAGAG TGG (reversed) Intergenic