ID: 969744495 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:9059469-9059491 |
| Sequence | GGGTCGTGATCATGAGAGAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 969744495_969744504 | 18 | Left | 969744495 | 4:9059469-9059491 | CCACTCTCTCATGATCACGACCC | No data | ||
| Right | 969744504 | 4:9059510-9059532 | AGAGTTGTGAGCCCTTAAAAGGG | No data | ||||
| 969744495_969744503 | 17 | Left | 969744495 | 4:9059469-9059491 | CCACTCTCTCATGATCACGACCC | No data | ||
| Right | 969744503 | 4:9059509-9059531 | TAGAGTTGTGAGCCCTTAAAAGG | No data | ||||
| 969744495_969744505 | 23 | Left | 969744495 | 4:9059469-9059491 | CCACTCTCTCATGATCACGACCC | No data | ||
| Right | 969744505 | 4:9059515-9059537 | TGTGAGCCCTTAAAAGGGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 969744495 | Original CRISPR | GGGTCGTGATCATGAGAGAG TGG (reversed) | Intergenic | ||