ID: 969744498

View in Genome Browser
Species Human (GRCh38)
Location 4:9059490-9059512
Sequence TCTAAGGGGGTCCGTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969744498_969744504 -3 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744504 4:9059510-9059532 AGAGTTGTGAGCCCTTAAAAGGG No data
969744498_969744510 25 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744510 4:9059538-9059560 AATTGCTCACTTGGAGAGCTGGG No data
969744498_969744509 24 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744509 4:9059537-9059559 GAATTGCTCACTTGGAGAGCTGG No data
969744498_969744508 16 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744508 4:9059529-9059551 AGGGACAGGAATTGCTCACTTGG No data
969744498_969744503 -4 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744503 4:9059509-9059531 TAGAGTTGTGAGCCCTTAAAAGG No data
969744498_969744505 2 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744505 4:9059515-9059537 TGTGAGCCCTTAAAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969744498 Original CRISPR TCTAAGGGGGTCCGTGTGAG AGG (reversed) Intergenic