ID: 969744503

View in Genome Browser
Species Human (GRCh38)
Location 4:9059509-9059531
Sequence TAGAGTTGTGAGCCCTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969744497_969744503 -3 Left 969744497 4:9059489-9059511 CCCTCTCACACGGACCCCCTTAG No data
Right 969744503 4:9059509-9059531 TAGAGTTGTGAGCCCTTAAAAGG No data
969744498_969744503 -4 Left 969744498 4:9059490-9059512 CCTCTCACACGGACCCCCTTAGA No data
Right 969744503 4:9059509-9059531 TAGAGTTGTGAGCCCTTAAAAGG No data
969744495_969744503 17 Left 969744495 4:9059469-9059491 CCACTCTCTCATGATCACGACCC No data
Right 969744503 4:9059509-9059531 TAGAGTTGTGAGCCCTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969744503 Original CRISPR TAGAGTTGTGAGCCCTTAAA AGG Intergenic