ID: 969748360

View in Genome Browser
Species Human (GRCh38)
Location 4:9091707-9091729
Sequence CAGCTAATGGGTAGAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748360_969748371 30 Left 969748360 4:9091707-9091729 CCCTGGCCTCTACCCATTAGCTG No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748360 Original CRISPR CAGCTAATGGGTAGAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr