ID: 969748362

View in Genome Browser
Species Human (GRCh38)
Location 4:9091713-9091735
Sequence TACTGGCAGCTAATGGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748362_969748371 24 Left 969748362 4:9091713-9091735 CCTCTACCCATTAGCTGCCAGTA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748362 Original CRISPR TACTGGCAGCTAATGGGTAG AGG (reversed) Intergenic
No off target data available for this crispr