ID: 969748363

View in Genome Browser
Species Human (GRCh38)
Location 4:9091719-9091741
Sequence TGGTGCTACTGGCAGCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748363_969748371 18 Left 969748363 4:9091719-9091741 CCCATTAGCTGCCAGTAGCACCA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748363 Original CRISPR TGGTGCTACTGGCAGCTAAT GGG (reversed) Intergenic
No off target data available for this crispr