ID: 969748365

View in Genome Browser
Species Human (GRCh38)
Location 4:9091730-9091752
Sequence GCTGGAGGAGGTGGTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748365_969748376 24 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748376 4:9091777-9091799 ACATGGCCACATGTTCTCTGGGG No data
969748365_969748377 25 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG No data
969748365_969748375 23 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748375 4:9091776-9091798 GACATGGCCACATGTTCTCTGGG No data
969748365_969748378 26 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748365_969748374 22 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748374 4:9091775-9091797 AGACATGGCCACATGTTCTCTGG No data
969748365_969748371 7 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748365 Original CRISPR GCTGGAGGAGGTGGTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr