ID: 969748366

View in Genome Browser
Species Human (GRCh38)
Location 4:9091739-9091761
Sequence GTTGTTGCGGCTGGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748366_969748371 -2 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748366_969748376 15 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748376 4:9091777-9091799 ACATGGCCACATGTTCTCTGGGG No data
969748366_969748377 16 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG No data
969748366_969748374 13 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748374 4:9091775-9091797 AGACATGGCCACATGTTCTCTGG No data
969748366_969748375 14 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748375 4:9091776-9091798 GACATGGCCACATGTTCTCTGGG No data
969748366_969748378 17 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748366 Original CRISPR GTTGTTGCGGCTGGAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr