ID: 969748367

View in Genome Browser
Species Human (GRCh38)
Location 4:9091742-9091764
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748367_969748378 14 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748367_969748375 11 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748375 4:9091776-9091798 GACATGGCCACATGTTCTCTGGG No data
969748367_969748374 10 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748374 4:9091775-9091797 AGACATGGCCACATGTTCTCTGG No data
969748367_969748371 -5 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748367_969748377 13 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG No data
969748367_969748376 12 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748376 4:9091777-9091799 ACATGGCCACATGTTCTCTGGGG No data
969748367_969748380 30 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748380 4:9091795-9091817 TGGGGGGCAAAATCACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748367 Original CRISPR TTGGTTGTTGCGGCTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr