ID: 969748368

View in Genome Browser
Species Human (GRCh38)
Location 4:9091745-9091767
Sequence GTTTTGGTTGTTGCGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748368_969748371 -8 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748368_969748376 9 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748376 4:9091777-9091799 ACATGGCCACATGTTCTCTGGGG No data
969748368_969748380 27 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748380 4:9091795-9091817 TGGGGGGCAAAATCACCCCCTGG No data
969748368_969748377 10 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG No data
969748368_969748374 7 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748374 4:9091775-9091797 AGACATGGCCACATGTTCTCTGG No data
969748368_969748378 11 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748368_969748375 8 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748375 4:9091776-9091798 GACATGGCCACATGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748368 Original CRISPR GTTTTGGTTGTTGCGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr