ID: 969748371

View in Genome Browser
Species Human (GRCh38)
Location 4:9091760-9091782
Sequence ACCAAAACTGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748364_969748371 17 Left 969748364 4:9091720-9091742 CCATTAGCTGCCAGTAGCACCAC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748361_969748371 29 Left 969748361 4:9091708-9091730 CCTGGCCTCTACCCATTAGCTGC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748366_969748371 -2 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748368_969748371 -8 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748367_969748371 -5 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748362_969748371 24 Left 969748362 4:9091713-9091735 CCTCTACCCATTAGCTGCCAGTA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748360_969748371 30 Left 969748360 4:9091707-9091729 CCCTGGCCTCTACCCATTAGCTG No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748365_969748371 7 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data
969748363_969748371 18 Left 969748363 4:9091719-9091741 CCCATTAGCTGCCAGTAGCACCA No data
Right 969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748371 Original CRISPR ACCAAAACTGTCTCCAGACA TGG Intergenic
No off target data available for this crispr