ID: 969748378

View in Genome Browser
Species Human (GRCh38)
Location 4:9091779-9091801
Sequence ATGGCCACATGTTCTCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969748372_969748378 -5 Left 969748372 4:9091761-9091783 CCAAAACTGTCTCCAGACATGGC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748367_969748378 14 Left 969748367 4:9091742-9091764 CCTCCTCCAGCCGCAACAACCAA No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748369_969748378 8 Left 969748369 4:9091748-9091770 CCAGCCGCAACAACCAAAACTGT No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748368_969748378 11 Left 969748368 4:9091745-9091767 CCTCCAGCCGCAACAACCAAAAC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748365_969748378 26 Left 969748365 4:9091730-9091752 CCAGTAGCACCACCTCCTCCAGC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748366_969748378 17 Left 969748366 4:9091739-9091761 CCACCTCCTCCAGCCGCAACAAC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data
969748370_969748378 4 Left 969748370 4:9091752-9091774 CCGCAACAACCAAAACTGTCTCC No data
Right 969748378 4:9091779-9091801 ATGGCCACATGTTCTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969748378 Original CRISPR ATGGCCACATGTTCTCTGGG GGG Intergenic
No off target data available for this crispr