ID: 969749911

View in Genome Browser
Species Human (GRCh38)
Location 4:9102197-9102219
Sequence ATGCACTAGAAGGGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969749911_969749915 -1 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749915 4:9102219-9102241 TGGAACATTATATAAAGAAAAGG No data
969749911_969749919 17 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749919 4:9102237-9102259 AAAGGGCCTACTGAACCCTGGGG No data
969749911_969749916 0 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749916 4:9102220-9102242 GGAACATTATATAAAGAAAAGGG No data
969749911_969749917 15 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749917 4:9102235-9102257 GAAAAGGGCCTACTGAACCCTGG No data
969749911_969749920 18 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data
969749911_969749918 16 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749918 4:9102236-9102258 AAAAGGGCCTACTGAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969749911 Original CRISPR ATGCACTAGAAGGGTTAAAA AGG (reversed) Intergenic
No off target data available for this crispr