ID: 969749913

View in Genome Browser
Species Human (GRCh38)
Location 4:9102206-9102228
Sequence TAATGTTCCATGCACTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969749913_969749915 -10 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749915 4:9102219-9102241 TGGAACATTATATAAAGAAAAGG No data
969749913_969749919 8 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749919 4:9102237-9102259 AAAGGGCCTACTGAACCCTGGGG No data
969749913_969749918 7 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749918 4:9102236-9102258 AAAAGGGCCTACTGAACCCTGGG No data
969749913_969749920 9 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data
969749913_969749917 6 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749917 4:9102235-9102257 GAAAAGGGCCTACTGAACCCTGG No data
969749913_969749916 -9 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749916 4:9102220-9102242 GGAACATTATATAAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969749913 Original CRISPR TAATGTTCCATGCACTAGAA GGG (reversed) Intergenic
No off target data available for this crispr