ID: 969749914

View in Genome Browser
Species Human (GRCh38)
Location 4:9102207-9102229
Sequence ATAATGTTCCATGCACTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969749914_969749918 6 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749918 4:9102236-9102258 AAAAGGGCCTACTGAACCCTGGG No data
969749914_969749920 8 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data
969749914_969749917 5 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749917 4:9102235-9102257 GAAAAGGGCCTACTGAACCCTGG No data
969749914_969749916 -10 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749916 4:9102220-9102242 GGAACATTATATAAAGAAAAGGG No data
969749914_969749919 7 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749919 4:9102237-9102259 AAAGGGCCTACTGAACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969749914 Original CRISPR ATAATGTTCCATGCACTAGA AGG (reversed) Intergenic
No off target data available for this crispr