ID: 969749920

View in Genome Browser
Species Human (GRCh38)
Location 4:9102238-9102260
Sequence AAGGGCCTACTGAACCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969749914_969749920 8 Left 969749914 4:9102207-9102229 CCTTCTAGTGCATGGAACATTAT No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data
969749911_969749920 18 Left 969749911 4:9102197-9102219 CCTTTTTAACCCTTCTAGTGCAT No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data
969749913_969749920 9 Left 969749913 4:9102206-9102228 CCCTTCTAGTGCATGGAACATTA No data
Right 969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969749920 Original CRISPR AAGGGCCTACTGAACCCTGG GGG Intergenic
No off target data available for this crispr