ID: 969751355

View in Genome Browser
Species Human (GRCh38)
Location 4:9113892-9113914
Sequence CCTCCTGGTGTTATTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969751349_969751355 4 Left 969751349 4:9113865-9113887 CCTTCACAATGGACCTTAATATT No data
Right 969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG No data
969751351_969751355 -9 Left 969751351 4:9113878-9113900 CCTTAATATTCCCACCTCCTGGT No data
Right 969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG No data
969751348_969751355 8 Left 969751348 4:9113861-9113883 CCATCCTTCACAATGGACCTTAA No data
Right 969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969751355 Original CRISPR CCTCCTGGTGTTATTCATTG TGG Intergenic
No off target data available for this crispr